Previous Contig 007823:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016H17Sequence562007823 (7)gb:BT008566_16397833e-28Arabidopsis thaliana clone U50865 unknown protein (At3g48030) mRNA, complete cds
JMFN018O24Sequence580007823 (7)gb:BT008566_16397831e-26Arabidopsis thaliana clone U50865 unknown protein (At3g48030) mRNA, complete cds
JMFN046A10Sequence589007823 (7)gb:BT008566_16397834e-28Arabidopsis thaliana clone U50865 unknown protein (At3g48030) mRNA, complete cds
JMSF019L14Sequence248007823 (7)gb:BT008566_16397833e-20Arabidopsis thaliana clone U50865 unknown protein (At3g48030) mRNA, complete cds114007823 (7)
JMSF048B24Sequence560007823 (7)gb:BT008566_16397833e-28Arabidopsis thaliana clone U50865 unknown protein (At3g48030) mRNA, complete cds167007823 (7)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018O24+ TTC
                      ____________________________________________________________
consensus TTC
 
. : . : . : . : . : . :
rJMSF048B24- AGTTCACAATAATGAGTTCATGTATATCTCGATGATGAACATC
JMFN018O24+ AGAAGAGAGAACATTATAGTTCACAATAATGAGTTCATGTATATCTCGATGATGAACATC
JMFN046A10+ GAACATC
                      ____________________________________________________________
consensus AGAAGAGAGAACATTATAGTTCACAATAATGAGTTCATGTATATCTCGATGATGAACATC
 
. : . : . : . : . : . :
rJMSF048B24- AAGAAACTCAAGAATCAATCAAACATGAGTTGTATACATCTTTGTTATACAAAATGGCTA
rJMSF019L14- AACATGAGTTGTATACATCTTTGTTATACAAAATGGCTA
JMFN018O24+ AAGAAACTCAAGAATC-ATCAAACATGAGTTGTATACATCTTTGTTATACAAAATGGCTA
JMFN046A10+ AAGAAACTCAAGAATCAATCAAACATGAGTTGTATACATCTTTGTTATACAAAATGGCTA
                      ____________________________________________________________
consensus AAGAAACTCAAGAATCAATCAAACATGAGTTGTATACATCTTTGTTATACAAAATGGCTA
 
. : . : . : . : . : . :
rJMSF048B24- CTGCTTGGCTTATTGAATGAAGCATCTAAACAGTTCAGGAAACAAAAAAAAAAA
rJMSF019L14- CTGCTTGGCTTATTGAATGAAGCATCTAAACAGTTCAGGAAAC-AAAAAAAAAAANGGAG
JMFN018O24+ CTGCTTGGCTTATTGAATGAAGCATCTAAACAGTTCAGGAAACAAAAAAAAAAAAAGGAG
JMFN046A10+ CTGCTTGGCTTATTGAATGAAGCATCTAAACAGTTCAGGAAACAAAAAAAAAAAAAGGAG
JMFF016H17+ AAAAAAAAAAAAGGAG
JMSF048B24+ AAAAAAAAAAAAGGAG
                      ____________________________________________________________
consensus CTGCTTGGCTTATTGAATGAAGCATCTAAACAGTTCAGGAAACAAAAAAAAAAAAAGGAG
 
. : . : . : . : . : . :
rJMSF019L14- TTTTTGACTTACAGCA
JMFN018O24+ TTTTTGACTTACAGCATTCATGGTGGAACTTGGAAGAGCTGAATGAGGTAAAGATGCCTT
JMFN046A10+ TTTTTGACTTACAGCATTCATGGTGGAACTTGGAAGAGCTGAATGAGGTAAAGATGCCTT
JMFF016H17+ TTTTTGACTTACAGCATTCATGGTGGAACTTGGAAGAGCTGAATGAGGTAAAGATGCCTT
JMSF048B24+ TTTTTGACTTACAGCATTCATGGTGGAACTTGGAAGAGCTGAATGAGGTAAAGATGCCTT
                      ____________________________________________________________
consensus TTTTTGACTTACAGCATTCATGGTGGAACTTGGAAGAGCTGAATGAGGTAAAGATGCCTT
 
. : . : . : . : . : . :
JMFN018O24+ TGTAGCAAGGTGTGTGATCAACTGATCATTTCTTGGTAGTAAAAAGCATTAAGTCTTGAG
JMFN046A10+ TGTAGCAAGGTGTGTGATCAACTGATCATTTCTTGGTAGTAAAAAGCATTAAGTCTTGAG
JMFF016H17+ TGTAGCAAGGTGTGTGATCAACTGATCATTTCTTGGTAGTAAAAAGCATTAAGTCTTGAG
JMSF048B24+ TGTAGCAAGGTGTGTGATCAACTGATCATTTCTTGGTAGTAAAAAGCATTAAGTCTTGAG
                      ____________________________________________________________
consensus TGTAGCAAGGTGTGTGATCAACTGATCATTTCTTGGTAGTAAAAAGCATTAAGTCTTGAG
 
. : . : . : . : . : . :
JMFN018O24+ AATGAAAAATGAGGCCGCAGAGATTGCTACTTTTGCAGTCATACAGTTTTAAGCATGTTT
JMFN046A10+ AATGAAAAATGAGGCCGCAGAGATTGCTACTTTTGCAGTCATACAGTTTTAAGCATGTTT
JMFF016H17+ AATGAAAAATGAGGCCGCAGAGATTGCTACTTTTGCAGTCATACAGTTTTAAGCATGTTT
JMSF048B24+ AATGAAAAATGAGGCCGCAGAGATTGCTACTTTTGCAGTCATACAGTTTTAAGCATGTTT
                      ____________________________________________________________
consensus AATGAAAAATGAGGCCGCAGAGATTGCTACTTTTGCAGTCATACAGTTTTAAGCATGTTT
 
. : . : . : . : . : . :
JMFN018O24+ GAGGTTGTCCCCATAGTAGTAAGCAGTCCCAACCATCAACGCCACCGTAGCGCCCTGTGC
JMFN046A10+ GAGGTTGTCCCCATAGTAGTAAGCAGTCCCAACCATCAACGCCACCGTAGCGCCCTGTGC
JMSF019L14+ CGTAGCGCCCTGTGC
JMFF016H17+ GAGGTTGTCCCCATAGTAGTAAGCAGTCCCAACCATCAACGCCACCGTAGCGCCCTGTGC
JMSF048B24+ GAGGTTGTCCCCATAGTAGTAAGCAGTCCCAACCATCAACGCCACCGTAGCGCCCTGTGC
                      ____________________________________________________________
consensus GAGGTTGTCCCCATAGTAGTAAGCAGTCCCAACCATCAACGCCACCGTAGCGCCCTGTGC
 
. : . : . : . : . : . :
JMFN018O24+ AACTACACGAGCCCTCATTAGCTTCTGACCTAAATTAGAATTTCCTTGCCGGAAACTAAT
JMFN046A10+ AACTACACGAGCCCTCATTAGCTTCTGACCTAAATTAGAATTTCCTTGCCGGAAACTAAT
JMSF019L14+ AACTACACGAGCCCTCATTAGCTTCTGACCTAAATTAGAATTTCCTTGCCGGAAACTAAT
JMFF016H17+ AACTACACGAGCCCTCATTAGCTTCTGACCTAAATTAGAATTTCCTTGCCGGAAACTAAT
JMSF048B24+ AACTACACGAGCCCTCATTAGCTTCTGACCTAAATTAGAATTTCCTTGCCGGAAACTAAT
                      ____________________________________________________________
consensus AACTACACGAGCCCTCATTAGCTTCTGACCTAAATTAGAATTTCCTTGCCGGAAACTAAT
 
. : . : . : . : . : . :
JMFN018O24+ CAATCCAGCTGTGAGCACTCCTGCAGTGACAAGTGCACCGAGGGGAACGAGAGGGTTTCT
JMFN046A10+ CAATCCAGCTGTGAGCACTCCTGCAGTGACAAGTGCACCGAGGGGAACGAGAGGGTTTCT
JMSF019L14+ CAATCCAGCTGTGAGCACTCCTGCAGTGACAAGTGCACCGAGGGGAACGAGAGGGTTTCT
JMFF016H17+ CAATCCAGCTGTGAGCACTCCTGCAGTGACAAGTGCACCGAGGGGAACGAGAGGGTTTCT
JMSF048B24+ CAATCCAGCTGTGAGCACTCCTGCAGTGACAAGTGCACCGAGGGGAACGAGAGGGTTTCT
                      ____________________________________________________________
consensus CAATCCAGCTGTGAGCACTCCTGCAGTGACAAGTGCACCGAGGGGAACGAGAGGGTTTCT
 
. : . : . : . : . : . :
JMFN018O24+ CACACGCTTCTTGTCCGCGAACAGTGCTTCCAATTCAG
JMFN046A10+ CACACGCTTCTTGTCCGCGAACAGTGCTTCCAATTCAGGATTAGTAGTCCCCATCTTTTC
JMSF019L14+ CACACGCTTCTTGTCCGCGAACAGTGCTTCCAATTCAGGATTAGTAGTCCCCATCTTTTC
JMFF016H17+ CACACGCTTCTTGTCCGCGAACAGTGCTTCCAATTCAGGATTAGTAGTCCCCATCTTTTC
JMSF048B24+ CACACGCTTCTTGTCCGCGAACAGTGCTTCCAATTCAGGATTAGTAGTCCCCATCTTTTC
                      ____________________________________________________________
consensus CACACGCTTCTTGTCCGCGAACAGTGCTTCCAATTCAGGATTAGTAGTCCCCATCTTTTC
 
. : . : . : . : . : . :
JMFN046A10+ CGGCCAACCGCCACCGCGCAGCTTTCCGATAACTGATTTAAA
JMSF019L14+ CGGCCAACCGCCACCGCGCAGCTTTCCGATAACTGATTTAAACGCGCTCT
JMFF016H17+ CGGCCAACCGCCACCGCGCAGCTTTCCGATAACTGATTTAAACGCGCTCTCCAATGTTAC
JMSF048B24+ CGGCCAACCGCCACCGCGCAGCTTTCCGATAACTGATTTAAACGCGCTCTCCAATGTTAC
                      ____________________________________________________________
consensus CGGCCAACCGCCACCGCGCAGCTTTCCGATAACTGATTTAAACGCGCTCTCCAATGTTAC
 
. : . : . : . : . : . :
JMFF016H17+ GCGCCTCCCGCCTGTTGCTTATATATTCACCTACTTTTCGACACTTGGAGCGCAAAGAC
JMSF048B24+ GCGCCTCCCGCCTGTTGCTTATATATTCACCTACTTTTCGACACTTGGAGCGCAAAGACC
                      ____________________________________________________________
consensus GCGCCTCCCGCCTGTTGCTTATATATTCACCTACTTTTCGACACTTGGAGCGCAAAGACC