Previous Contig 007822:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001A07Sequence441007822 (5)gb:ATAC010676_15431337e-08Arabidopsis thaliana chromosome III BAC T22N4 genomic sequence, complete sequenc611007822 (5)gb:AB024511_15159573e-58Nicotiana tabacum mRNA for TMV response-related gene product, complete cds.
JMFN006B22Sequence547007822 (5)gb:AB024511_15159571e-46Nicotiana tabacum mRNA for TMV response-related gene product, complete cds.
JMSF048B22Sequence694007822 (5)gb:ATAC010676_15431331e-31Arabidopsis thaliana chromosome III BAC T22N4 genomic sequence, complete sequenc701007822 (5)gb:AB024511_15159572e-77Nicotiana tabacum mRNA for TMV response-related gene product, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN006B22+ AATTGTAAAAGGCTTATAGAGTTAAATAAATGTATGAATTTGGTAG
rJMFF001A07- CTTATAGAGTTAAATAAATGTATGAATTTGGTAG
                      ____________________________________________________________
consensus AATTGTAAAAGGCTTATAGAGTTAAATAAATGTATGAATTTGGTAG
 
. : . : . : . : . : . :
JMFN006B22+ CAGCAGCAGGAAAACAAAACTATCAAGAACAAATACAATCCAGAACTGAAGAGAAGGAGA
rJMFF001A07- CAGCAGCAGGAAAACAAAACTATCAAGAACAAATACAATCCAGAACTGAAGAGAAGGAGA
rJMSF048B22- AAACTATCAAGAACAAATACAATCCAGAACTGAAGAGAAGGAGA
                      ____________________________________________________________
consensus CAGCAGCAGGAAAACAAAACTATCAAGAACAAATACAATCCAGAACTGAAGAGAAGGAGA
 
. : . : . : . : . : . :
JMFN006B22+ TACTATGTGTGTGGGAAATAAATATTCACTGGTGAGCATGAAAGCCATTAGCTGCCACCC
rJMFF001A07- TACTATGTGTGTGGGAAATAAATATTCACTGGTGAGCATGAAAGCCATTAGCTGCCACCC
rJMSF048B22- TACTATGTGTGTGGGAAATAAATATTCACTGGTGAGCATGAAAGCCATTAGCTGCCACCC
                      ____________________________________________________________
consensus TACTATGTGTGTGGGAAATAAATATTCACTGGTGAGCATGAAAGCCATTAGCTGCCACCC
 
. : . : . : . : . : . :
JMFN006B22+ CTGGCATTCCCAAAGCATTATGATGATTCGCTCCTTCATCGTCATCGGACTCCAAAGAAA
rJMFF001A07- CTGGCATTCCCAAAGCATTATGATGATTCGCTCCTTCATCGTCATCGGACTCCAAAGAAA
rJMSF048B22- CTGGCATTCCCAAAGCATTATGATGATTCGCTCCTTCATCGTCATCGGACTCCAAAGAAA
                      ____________________________________________________________
consensus CTGGCATTCCCAAAGCATTATGATGATTCGCTCCTTCATCGTCATCGGACTCCAAAGAAA
 
. : . : . : . : . : . :
JMFN006B22+ AAGCAGAGCAAGCACCCATTTCCATCTGCTGCACCTCTGCTCCAATCGGTCTATACTTGC
rJMFF001A07- AAGCAGAGCAAGCACCCATTTCCATCTGCTGCACCTCTGCTCCAATCGGTCTATACTTGC
rJMSF048B22- AAGCAGAGCAAGCACCCATTTCCATCTGCTGCACCTCTGCTCCAATCGGTCTATACTTGC
                      ____________________________________________________________
consensus AAGCAGAGCAAGCACCCATTTCCATCTGCTGCACCTCTGCTCCAATCGGTCTATACTTGC
 
. : . : . : . : . : . :
JMFN006B22+ TACTTTCCTGCCTAATCCCATTCTTCTTACAAACTATACAGAAAACTACAGAAACAATGG
rJMFF001A07- TACTTTCCTGCCTAATCCCATTCTTCTTACAAACTATACAGAAAACTACAGAAACAATGG
rJMSF048B22- TACTTTCCTGCCTAATCCCATTCTTCTTACAAACTATACAGAAAACTACAGAAACAATGG
                      ____________________________________________________________
consensus TACTTTCCTGCCTAATCCCATTCTTCTTACAAACTATACAGAAAACTACAGAAACAATGG
 
. : . : . : . : . : . :
JMFN006B22+ TGACAAGCAGAACAAGATGGCAATTGAACTGAAGCGTGGCAATGGCTCGACCTCGGTGGT
rJMFF001A07- TGACAAGCAGAACAAGATGGCAATTGAACTGAAGCGTGGCAATGGCTCGACCTCGGTGGT
rJMSF048B22- TGACAAGCAGAACAAGATGGCAATTGAACTGAAGCGTGGCAATGGCTCGACCTCGGTGGT
                      ____________________________________________________________
consensus TGACAAGCAGAACAAGATGGCAATTGAACTGAAGCGTGGCAATGGCTCGACCTCGGTGGT
 
. : . : . : . : . : . :
JMFN006B22+ ATTCATGTTGCCCCTTGCACTTCACCGTGTAATTACCTCTACTTCTCTCGTGCAATGCGC
rJMFF001A07- ATTCATGTTGCCCCTTGCACTTCACCGTGTAATTACCTCTACTTCTCTCGTGCAATGCGC
rJMSF048B22- ATTCATGTTGCCCCTTGCACTTCACCGTGTAATTACCTCTACTTCTCTCGTGCAATGCGC
                      ____________________________________________________________
consensus ATTCATGTTGCCCCTTGCACTTCACCGTGTAATTACCTCTACTTCTCTCGTGCAATGCGC
 
. : . : . : . : . : . :
JMFN006B22+ AGCCATGAGCCATCAGGCCTGAGAAAAATGAGAACCCCATTTGCAGAATCCACATTCCTT
rJMFF001A07- AGCCATGAGCCATCAGGCCTGAGAAAAATGAGAACCCCATTTGCAGAATCCACATTCCTT
rJMSF048B22- AGCCATGAGCCATCAGGCCTGAGAAAAATGAGAACCCCATTTGCAGAATCCACATTCCTT
                      ____________________________________________________________
consensus AGCCATGAGCCATCAGGCCTGAGAAAAATGAGAACCCCATTTGCAGAATCCACATTCCTT
 
. : . : . : . : . : . :
JMFN006B22+ GTAAGACCAGCCCGATCCCTC
rJMFF001A07- GTAAGACCAGCCCGATCCCTCGCCCCAGTCTACAGTAATTCCTTTGGGGATTTTTCAATT
rJMSF048B22- GTAAGACCAGCCCGATCCCTCGCCCCAGTCTACAGTAATTCCTTTGGGGATTTTTCAATT
JMSF048B22+ AGTCTACAGTNATTCCTTTGGGGATTTTTCAATT
                      ____________________________________________________________
consensus GTAAGACCAGCCCGATCCCTCGCCCCAGTCTACAGTAATTCCTTTGGGGATTTTTCAATT
 
. : . : . : . : . : . :
rJMFF001A07- CGAGAATCGTACAGAATGCACAGGCAGCAATTGGCAC
rJMSF048B22- CGAGAATCGTACAGAATGCACAGGCAGCAATTGGCACTAGGAAGAGATCATAGTAACGAT
JMSF048B22+ CGAGAATCGTACAGAATGCACAGGCAGCAATTGGCACTAGGAAGAGATCATAGTAACGAT
                      ____________________________________________________________
consensus CGAGAATCGTACAGAATGCACAGGCAGCAATTGGCACTAGGAAGAGATCATAGTAACGAT
 
. : . : . : . : . : . :
rJMSF048B22- TTTCAACCCCGCTGGGGTCTTTCCTCTGAATGTAAAATATTAAAAATTCCTCCCCGAATG
JMSF048B22+ TTTCAACCCCGCTGGGGTCTTTCCTCTGAATGTAAAATATTAAAAATTCCTCCCCGAATG
                      ____________________________________________________________
consensus TTTCAACCCCGCTGGGGTCTTTCCTCTGAATGTAAAATATTAAAAATTCCTCCCCGAATG
 
. : . : . : . : . : . :
rJMSF048B22- CAAAGAGGGAAATCAAATTGGGGATTTGACAAGGCAATTGAAGAGAATCTTTTGA
JMFF001A07+ TGAACGGC
JMSF048B22+ CAAAGAGGGAAATCAAATTGGGGATTTGACAAGGCAATTGAAGAGAATCTTTTGAACGGC
                      ____________________________________________________________
consensus CAAAGAGGGAAATCAAATTGGGGATTTGACAAGGCAATTGAAGAGAATCTTTTGAACGGC
 
. : . : . : . : . : . :
JMFF001A07+ TAAAGAAGCCGACCACAGAGTAGAGGATGAAAAGGAGCGAAATCGAGATTACCTCCAACT
JMSF048B22+ TAAAGAAGCCGACCACAGAGTAGAGGATGAAAAGGAGCGAAATCGAGATTACCTCCAACT
                      ____________________________________________________________
consensus TAAAGAAGCCGACCACAGAGTAGAGGATGAAAAGGAGCGAAATCGAGATTACCTCCAACT
 
. : . : . : . : . : . :
JMFF001A07+ GGATAACCACGCCGACATCATCTTCGGAGCTGATGGCATCGGAGATTGAGATTAGTGAGT
JMSF048B22+ GGATAACCACGCCGACATCATCTTCGGAGCTGATGGCATCGGAGATTGAGATTAGTGAGT
                      ____________________________________________________________
consensus GGATAACCACGCCGACATCATCTTCGGAGCTGATGGCATCGGAGATTGAGATTAGTGAGT
 
. : . : . : . : . : . :
JMFF001A07+ TGACAATGAAGAGAAACGAGAGAACAGAACCTGCTAGGAATGTTGCGGAGGAGGAAATCC
JMSF048B22+ TGACAATGAAGAGAAACGAGAGAACAGAACCTGCTAGGAATGTTGCGGAGGAGGAAATCC
                      ____________________________________________________________
consensus TGACAATGAAGAGAAACGAGAGAACAGAACCTGCTAGGAATGTTGCGGAGGAGGAAATCC
 
. : . : . : . : . : . :
JMFF001A07+ GTGTGGATTTGGGGGT-GTTATGTCCGCTAATTGAGGCTGTTCCAGCGGTGACGGTGGCG
JMSF048B22+ GTGTGGATTTGGGGGTGGTTATGTCCGCTAATTGAGGCTGTTCCAGCGGTGACGGTGGCG
                      ____________________________________________________________
consensus GTGTGGATTTGGGGGTGGTTATGTCCGCTAATTGAGGCTGTTCCAGCGGTGACGGTGGCG
 
. : . : . : . : . : . :
JMFF001A07+ GTGGCGTCACCTTCAAGGTTTCTTTGGACGATGCGAAAGCTTCCCAAGCGCCGATCATTA
JMSF048B22+ GTGGCGTCACCTTCAAGGTTTCTTTGGACGATGCGAAAGCTTCCCAAGCGCCGATCATTA
                      ____________________________________________________________
consensus GTGGCGTCACCTTCAAGGTTTCTTTGGACGATGCGAAAGCTTCCCAAGCGCCGATCATTA
 
. : . : . : . : . : . :
JMFF001A07+ TGAATCCACCGCCGGCGACGGTGTACGAGAAGAGGCCCATCGTTGACTCCGATCAACACG
JMSF048B22+ TGAATCCACCGCCGGCGACGGTGTACGAGAAGAGGCCCATCGTTGACTCCGATCAACACG
                      ____________________________________________________________
consensus TGAATCCACCGCCGGCGACGGTGTACGAGAAGAGGCCCATCGTTGACTCCGATCAACACG
 
. : . : . : . : . : . :
JMFF001A07+ ATAGTGAGCTTGCCGGTATCGGTATTTCAATATTGTTTATGCTAGAGCTAGTGATCGAAA
JMSF048B22+ ATAGTGAGCTTGCCGGTATCGGTATTTCAATATTGTTTATGCTAGAGCTAGTGATCGAAA
                      ____________________________________________________________
consensus ATAGTGAGCTTGCCGGTATCGGTATTTCAATATTGTTTATGCTAGAGCTAGTGATCGAAA
 
. : . : . : . : . : . :
JMFF001A07+ GCGGATGGAAGAAT
JMSF048B22+ GCGGATGGAAGAATGGATCGGCAGGCAGCAGTTCTGTTGGGGATTGAACCCTCTTGTCTC
                      ____________________________________________________________
consensus GCGGATGGAAGAATGGATCGGCAGGCAGCAGTTCTGTTGGGGATTGAACCCTCTTGTCTC