Previous Contig 007820:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS009A12Sequence599007820 (7)pir|T45746|T457461e-63hypothetical protein F24M12.190 - Arabidopsis thaliana>gb:ATF24M12_1549954 Arabi
JMFS020A06Sequence605007820 (7)pir|T45746|T457464e-60hypothetical protein F24M12.190 - Arabidopsis thaliana>gb:ATF24M12_1549954 Arabi
JMFS118E10Sequence619007820 (7)pir|T45746|T457461e-63hypothetical protein F24M12.190 - Arabidopsis thaliana>gb:ATF24M12_1549954 Arabi
JMFS122C01Sequence540007820 (7)pir|T45746|T457465e-49hypothetical protein F24M12.190 - Arabidopsis thaliana>gb:ATF24M12_1549954 Arabi
JMFS123H02Sequence577007820 (7)pir|T45746|T457464e-73hypothetical protein F24M12.190 - Arabidopsis thaliana>gb:ATF24M12_1549954 Arabi
JMFS148G10Sequence617007820 (7)pir|T45746|T457465e-62hypothetical protein F24M12.190 - Arabidopsis thaliana>gb:ATF24M12_1549954 Arabi
JMSF048B06Sequence678007820 (7)pir|T45746|T457461e-65hypothetical protein F24M12.190 - Arabidopsis thaliana>gb:ATF24M12_1549954 Arabi806024292gb:AF272759_17822575e-44Zea mays kinesin heavy chain (KIN15) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS123H02+ TCAGCCGGGCCCCAGCTGATAAAGATTGAGATGCACG
                      ____________________________________________________________
consensus TCAGCCGGGCCCCAGCTGATAAAGATTGAGATGCACG
 
. : . : . : . : . : . :
JMFS123H02+ CTCACTTCCGGCCAAATCAACAAAATTCACGGTAGCTATAAGAGAGTTTGAATTGTCCCT
                      ____________________________________________________________
consensus CTCACTTCCGGCCAAATCAACAAAATTCACGGTAGCTATAAGAGAGTTTGAATTGTCCCT
 
. : . : . : . : . : . :
JMFS123H02+ CCCTAAGAATTCGCGAACTGAGCTTTCGACGGTCAATCTGATTATTTGGTGAGATCGAGA
                      ____________________________________________________________
consensus CCCTAAGAATTCGCGAACTGAGCTTTCGACGGTCAATCTGATTATTTGGTGAGATCGAGA
 
. : . : . : . : . : . :
JMFS123H02+ GCTCGTTTCATTTAGGTTCGTTTCCCCAATCTGTCTTTGAGCTTCGCATATGGAAAGAAG
JMSF048B06+ TTCGCATATGGAAAGAAG
                      ____________________________________________________________
consensus GCTCGTTTCATTTAGGTTCGTTTCCCCAATCTGTCTTTGAGCTTCGCATATGGAAAGAAG
 
. : . : . : . : . : . :
JMFS123H02+ ATCCACCACATGGTTCCAGTCCTCCACAGTTTCTTCAGTGAGTTTCTCAACAACCGTCCC
JMFS009A12+ TCAGTGAGTTTCTCAACAACCGTCCC
JMFS020A06+ CAACAACCGTCCC
JMFS148G10+ TCAACAACCGTCCC
JMFS118E10+ CTCAACAACCGTCCC
JMSF048B06+ ATCCACCACATGGTTCCAGTCCTCCACAGTTTCTTCAGTGAGTTTCTCAACAACCGTCCC
                      ____________________________________________________________
consensus ATCCACCACATGGTTCCAGTCCTCCACAGTTTCTTCAGTGAGTTTCTCAACAACCGTCCC
 
. : . : . : . : . : . :
JMFS123H02+ TCTCTCGGGATCATCCAGAAGTCTAAGTGGAGTGACATCTGAAGAGAGAAGGTCCCTAAC
JMFS009A12+ TCTCTCGGGATCATCCAGAAGTCTAAGTGGAGTGACATCTGAAGAGAGAAGGTCCCTAAC
JMFS020A06+ TCTGTACGTATCATCCAGAAGTCTAAGTGGAGTGACATCTGAAGAGAGAAGGTCCCTAAC
JMFS148G10+ TCTCTCGGGATCATCCAGAAGTCTAAGTGGAGTGACATCTGAAGAGAGAAGGTCCCTAAC
JMFS118E10+ TCTCTCGGGATCATCCAGAAGTCTAAGTGGAGTGACATCTGAAGAGAGAAGGTCCCTAAC
JMSF048B06+ TCTCTCGGGATCATCCAGAAGTCTAAGTGGAGTGACATCTGAAGAGAGAAGGTCCCTAAC
                      ____________________________________________________________
consensus TCTCTCGGGATCATCCAGAAGTCTAAGTGGAGTGACATCTGAAGAGAGAAGGTCCCTAAC
 
. : . : . : . : . : . :
JMFS123H02+ AGACTCGTTGTAGATCTCCATAGCCGACAACTTCAAAACATAATCTCTCTCGGTATGTTT
JMFS009A12+ AGACTCGTTGTAGATCTCCATAGCCGACAACTTCAAAACATAATCTCTCTCGGTATGTTT
JMFS122C01+ ACTCGTTGTAGATCTCCATAGCCGACAACTTCAAAACATAATCTCTCTCGGTATGTTT
JMFS020A06+ AGACTCGTTGTAGATCTCCATAGCCGACAACTTCAAAACATAATCTCTCTCGGTATGTTT
JMFS148G10+ AGACTCGTTGTAGATCTCCATAGCCGACAACTTCAAAACATAATCTCTCTCGGTATGTTT
JMFS118E10+ AGACTCGTTGTAGATCTCCATAGCCGACAACTTCAAAACATAATCTCTCTCGGTATGTTT
JMSF048B06+ AGACTCGTTGTAGATCTCCATAGCCGACAACTTCAAAACATAATCTCTCTCGGTATGTTT
                      ____________________________________________________________
consensus AGACTCGTTGTAGATCTCCATAGCCGACAACTTCAAAACATAATCTCTCTCGGTATGTTT
 
. : . : . : . : . : . :
JMFS123H02+ TTGTATATGGTCATATATATCGGAAATGGCATACTCTGTAATTCCAGTCATGGTATACGT
JMFS009A12+ TTGTATATGGTCATATATATCGGAAATGGCATACTCTGTAATTCCAGTCATGGTATACGT
JMFS122C01+ TTGTATATGGTCATATATATCGGAAATGGCATACTCTGTAATTCCAGTCATGGTATACGT
JMFS020A06+ TTGTATATGGTCATATATATCGGAAATGGCATACTCTGTAATTCCAGTCATGGTATACGT
JMFS148G10+ TTGTATATGGTCATATATATCGGAAATGGCATACTCTGTAATTCCAGTCATGGTATACGT
JMFS118E10+ TTGTATATGGTCATATATATCGGAAATGGCATACTCTGTAATTCCAGTCATGGTATACGT
JMSF048B06+ TTGTATATGGTCATATATATCGGAAATGGCATACTCTGTAATTCCAGTCATGGTATACGT
                      ____________________________________________________________
consensus TTGTATATGGTCATATATATCGGAAATGGCATACTCTGTAATTCCAGTCATGGTATACGT
 
. : . : . : . : . : . :
JMFS123H02+ CTTTCCACTGCTCGTTTGTCCATACGCAAAAACACTTGAATTGAATCCATTAACAACGGA
JMFS009A12+ CTTTCCACTGCTCGTTTGTCCATACGCAAAAACACTTGAATTGAATCCATTAACAACGGA
JMFS122C01+ CTTTCCACTGCTCGTTTGTCCATACGCAAAAACACTTGAATTGAATCCATTAACAACGGA
JMFS020A06+ CTTTCCACTGCTCGTTTGTCCATACGCAAAAACACTTGAATTGAATCCATTAACAACGGA
JMFS148G10+ CTTTCCACTGCTCGTTTGTCCATACGCAAAAACACTTGAATTGAATCCATTAACAACGGA
JMFS118E10+ CTTTCCACTGCTCGTTTGTCCATACGCAAAAACACTTGAATTGAATCCATTAACAACGGA
JMSF048B06+ CTTTCCACTGCTCGTTTGTCCATACGCAAAAACACTTGAATTGAATCCATTAACAACGGA
                      ____________________________________________________________
consensus CTTTCCACTGCTCGTTTGTCCATACGCAAAAACACTTGAATTGAATCCATTAACAACGGA
 
. : . : . : . : . : . :
JMFS123H02+ TAGAGCAACTTCCTTAGCTGCTTCCTCGTACACCTTTCTCGTGGAGCAATCACTGTTAAA
JMFS009A12+ TAGAGCAACTTCCTTAGCTGCTTCCTCGTACACCTTTCTCGTGGAGCAATCACTGATAAA
JMFS122C01+ TAGAGCAACTTCCTTAGCTGCTTCCTCGTACACCTTTCTCGTGGAGCAATCACTGTTAAA
JMFS020A06+ TAGAGCAACTTCCTTAGCTGCTTCCTCGTACACCTTTCTCGTGGAGCAATCACTGTTAAA
JMFS148G10+ TAGAGCAACTTCCTTAGCTGCTTCCTCGTACACCTTTCTCGTGGAGCAATCACTGTTAAA
JMFS118E10+ TAGAGCAACTTCCTTAGCTGCTTCCTCGTACACCTTTCTCGTGGAGCAATCACTGTTAAA
JMSF048B06+ TAGAGCAACTTCCTTAGCTGCTTCCTCGTACACCTTTCTCGTGGAGCAATCACTGTTAAA
                      ____________________________________________________________
consensus TAGAGCAACTTCCTTAGCTGCTTCCTCGTACACCTTTCTCGTGGAGCAATCACTGTTAAA
 
. : . : . : . : . : . :
JMFS009A12+ TACCCTGTCAAATCCATAGACGGAGGGATACATAGACCTCTCAGAAGCCGAGAGATCAAC
JMFS122C01+ TACCCTGTCAAATCCATAGACGGAGGGATACATAGACCTCTCAGAAGCCGAGAGATCAAC
JMFS020A06+ TACCCTGTCAAATCCATAGACGGAGGGATACATAGACCTCTCAGAAGCCGAGAGATCAAC
JMFS148G10+ TACCCTGTCAAATACATAGACGGAGGGATACATAGACCTCTCAGAAGCCGAGAGATCAAC
JMFS118E10+ TACCCTGTCAAATCCATAGACGGAGGGATACATAGACCTCTCAGAAGCCGAGAGATCAAC
JMSF048B06+ TACCCTGTCAAATCCATAGACGGAGGGATACATAGACCTCTCAGAAGCCGAGAGATCAAC
                      ____________________________________________________________
consensus TACCCTGTCAAATCCATAGACGGAGGGATACATAGACCTCTCAGAAGCCGAGAGATCAAC
 
. : . : . : . : . : . :
JMFS009A12+ ATTCCTGTAAACAATGGTGGTTTGATTGACACACCCCCAATCCGAAACATCATTCCTTAA
JMFS122C01+ ATTCCTGTAAACAATGGTGGTTTGATTGGCACACCCCCAATCCGAAACATCATTCCTTAA
JMFS020A06+ ATTCCTGTAAACAATGGTGGTTTGATTGACACACCCCCAATCCGAAACATCATTCCTTAA
JMFS148G10+ ATTCCTGTAAACAATGGTGGTTTGATTGACACACCCCCAATCCGAAACATCATTCCTTAA
JMFS118E10+ ATTCCTGTAAACAATGGTGGTTTGATTGACACACCCCCAATCCGAAACATCATTCCTTAA
JMSF048B06+ ATTCCTGTAAACAATGGTGGTTTGATTGACACACCCCCAATCCGAAACATCATTCCTTAA
                      ____________________________________________________________
consensus ATTCCTGTAAACAATGGTGGTTTGATTGACACACCCCCAATCCGAAACATCATTCCTTAA
 
. : . : . : . : . : . :
JMFS009A12+ AATCTCCTTGTGATTCAAAGGCCTTAGCCGCACCGACACCAAAATCCTCTCCCCTCTCAT
JMFS122C01+ AATCTCCTTGTGATTCAAAGGCCTTAGCCGCACCGACACCAAAATCCTCT
JMFS020A06+ AATCTCCTTGTGATTCAAAGGCCTTAGCCGCACCGACACCAAAATCCTCTCCCCTCTCAT
JMFS148G10+ AATCTCCTTGTGATTCAAAGGCCTTAGCCGCACCGACACCAAAATCCTCT
JMFS118E10+ AATCTCCTTGTGATTCAAAGGCCTTAGCCGCACCGACACCAAAATCCTCT
JMSF048B06+ AATCTCCTTGTGATTCAAAGGCCTTAGCCGCACCGACACCAAAATCCTCTCCCCTCTCAT
                      ____________________________________________________________
consensus AATCTCCTTGTGATTCAAAGGCCTTAGCCGCACCGACACCAAAATCCTCTCCCCTCTCAT
 
. : . : . : . : . : . :
JMFS009A12+ CGTCTCTTCTCCTCTTCCCTCCATGCCACCTTTTTCTTCCCAAAGCACATATGACTACAA
JMFS020A06+ CGTCTCTTCTCCTCCTCCCTCCATGCCACCTTTTTCTTCCCAAAGCACATATGACTACAA
JMSF048B06+ CGTCTCTTCTCCTCCTCCCTCCATGCCACCTTTTTCTTCCCAAAGCACATATGACTACAA
                      ____________________________________________________________
consensus CGTCTCTTCTCCTCCTCCCTCCATGCCACCTTTTTCTTCCCAAAGCACATATGACTACAA
 
. : . : . : . : . : . :
JMFS009A12+ AATTCCACACAATAATTTTTCAATGCATTGAAC
JMFS020A06+ AATTCCACACAATAATTTTTCAATGCATTGAAC-AAAAAAAACACAGATGGGC
JMSF048B06+ AATTCCACACAATAATTTTTCAATGCATTGAACAAAAAAAAACACAGATGGGCCTCCACC
                      ____________________________________________________________
consensus AATTCCACACAATAATTTTTCAATGCATTGAACAAAAAAAAACACAGATGGGCCTCCACC