Previous Contig 007819:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS004A06Sequence506007819 (6)gb:AY899999_16320564e-32Vitis vinifera clone BACCA01_001393 sucrose-phosphate synthase 1 mRNA, complete
JMFS033E05Sequence596007819 (6)gb:AY899999_16320564e-44Vitis vinifera clone BACCA01_001393 sucrose-phosphate synthase 1 mRNA, complete
JMFS044E09Sequence623007819 (6)gb:AY899999_16320563e-44Vitis vinifera clone BACCA01_001393 sucrose-phosphate synthase 1 mRNA, complete
JMFS084B08Sequence615007819 (6)gb:AY899999_16320563e-44Vitis vinifera clone BACCA01_001393 sucrose-phosphate synthase 1 mRNA, complete
JMFS139F11Sequence626007819 (6)gb:AY899999_16320563e-44Vitis vinifera clone BACCA01_001393 sucrose-phosphate synthase 1 mRNA, complete
JMSF048A09Sequence688007819 (6)gb:AY899999_16320569e-49Vitis vinifera clone BACCA01_001393 sucrose-phosphate synthase 1 mRNA, complete 811024288gb:AY899999_16320569e-79Vitis vinifera clone BACCA01_001393 sucrose-phosphate synthase 1 mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048A09+ TCGTCATCACACCATATCTGTGTATCTG
                      ____________________________________________________________
consensus TCGTCATCACACCATATCTGTGTATCTG
 
. : . : . : . : . : . :
JMFS084B08+ AGCAAGGGAATCTATCCGATTCATTTCCCCTCCTTTCTCCT
JMFS033E05+ CATTTCCCCTCCTTTCTCCT
JMFS139F11+ AGCAAGGGAATCTATCCGATTCATTTCCCCTCCTTTCTCCT
JMFS044E09+ AGCAAGGGAATCTATCCGATTCATTTCCCCTCCTTTCTCCT
JMSF048A09+ AGTTAATTCTTGGCATATAAGCAAGGGAATCTATCCGATTCATTTCCCCTCCTTTCTCCT
                      ____________________________________________________________
consensus AGTTAATTCTTGGCATATAAGCAAGGGAATCTATCCGATTCATTTCCCCTCCTTTCTCCT
 
. : . : . : . : . : . :
JMFS084B08+ TCCAATTCTCGCCTTCCGAGAGTTCAGAAAGATCCTCTGCTGCATCGATACGACCTTTCT
JMFS033E05+ TCCAATTCTCGCCTTCCGAGAGTTCAGAAAGATCCTCTGCTGCATCGATACGACCTTTCT
JMFS139F11+ TCCAATTCTCGCCTTCCGAGAGTTCAGAAAGATCCTCTGCTGCATCGATACGACCTTTCT
JMFS044E09+ TCCAATTCTCGCCTTCCGAGAGTTCAGAAAGATCCTCTGCTGCATCGATACGACCTTTCT
JMSF048A09+ TCCAATTCTCGCCTTCCGAGAGTTCAGAAAGATCCTCTGCTGCATCGATACGACCTTTCT
                      ____________________________________________________________
consensus TCCAATTCTCGCCTTCCGAGAGTTCAGAAAGATCCTCTGCTGCATCGATACGACCTTTCT
 
. : . : . : . : . : . :
JMFS084B08+ CGAGCTCAACCCTCCTTTTCACCAACCTTTGTGCATCCTCTGAAGCTATCTGTTTCTTCT
JMFS033E05+ CGAGCTCAACCCTCCTTTTCACCAACCTTTGTGCATCCTCTGAAGCTATCTGTTTCTTCT
JMFS139F11+ CGAGCTCAACCCTCCTTTTCACCAACCTTTGTGCATCCTCTGAAGCTATCTGTTTCTTCT
JMFS044E09+ CGAGCTCAACCCTCCTTTTCACCAACCTTTGTGCATCCTCTGAAGCTATCTGTTTCTTCT
JMFS004A06+ TCCTTTTCACCAACCTTTGTGCATCCTCTGAAGCTATCTGTTTCTTCG
JMSF048A09+ CGAGCTCAACCCTCCTTTTCACCAACCTTTGTGCATCCTCTGAAGCTATCTGTTTCTTCT
                      ____________________________________________________________
consensus CGAGCTCAACCCTCCTTTTCACCAACCTTTGTGCATCCTCTGAAGCTATCTGTTTCTTCT
 
. : . : . : . : . : . :
JMFS084B08+ TGCGGGAGAGATGCCAAATCCTCCAGCACATATTCTCGAGCCTGTTATTGCGCTCCCGAG
JMFS033E05+ TGCGGGAGAGATGCCAAATCCTCCAGCACATATTCTCGAGCCTGTTATTGCGCTCCCGAG
JMFS139F11+ TGCGGGAGAGATGCCAAATCCTCCAGCACATATTCTCGAGCCTGTTATTGCGCTCCCGAG
JMFS044E09+ TGCGGGAGAGATGCCAAATCCTCCAGCACATATTCTCGAGCCTGTTATTGCGCTCCCGAG
JMFS004A06+ TGCGGGAGAGATGCCAAATCCTCCAGCACATATTCTCGAGCCTGTTATTGCGCTCCCGAG
JMSF048A09+ TGCGGGAGAGATGCCAAATCCTCCAGCACATATTCTCGAGCCTGTTATTGCGCTCCCGAG
                      ____________________________________________________________
consensus TGCGGGAGAGATGCCAAATCCTCCAGCACATATTCTCGAGCCTGTTATTGCGCTCCCGAG
 
. : . : . : . : . : . :
JMFS084B08+ AATTCCTTGTTGCTACAACCTTAATCCATGTCCTGTGGAGGTCAGTCTCATCGAAGCTGT
JMFS033E05+ AATTCCTTGTTGCTACAACCTTAATCCATGTCCTGTGGAGGTCAGTCTCATCGAAGCTGT
JMFS139F11+ AATTCCTTGTTGCTACAACCTTAATCCATGTCCTGTGGAGGTCAGTCTCATCGAAGCTGT
JMFS044E09+ AATTCCTTGTTGCTACAACCTTAATCCATGTCCTGTGGAGGTCAGTCTCATCGAAGCTGT
JMFS004A06+ AATTCCTTGTTGCTACAACCTTAATCCATGTCCTGTGGAGGTCAGTCTCATCGAAGCTGT
JMSF048A09+ AATTCCTTGTTGCTACAACCTTAATCCATGTCCTGTGGAGGTCAGTCTCATCGAAGCTGT
                      ____________________________________________________________
consensus AATTCCTTGTTGCTACAACCTTAATCCATGTCCTGTGGAGGTCAGTCTCATCGAAGCTGT
 
. : . : . : . : . : . :
JMFS084B08+ TAACAACCTCTTCAACAAAGTACTTGGTCGGACTAAACAGCTGCAATACTGGTTTCTCTT
JMFS033E05+ TAACAACCTCTTCAACAAAGTACTTGGTCGGACTAAACAGCTGCAATACTGGTTTCTCTT
JMFS139F11+ TAACAACCTCTTCAACAAAGTACTTGGTCGGACTAAACAGCTGCAATACTGGTTTCTCTT
JMFS044E09+ TAACAACCTCTTCAACAAAGTACTTGGTCGGACTAAACAGCTGCAATACTGGTTTCTCTT
JMFS004A06+ TAACAACCTCTTCAACAAAGTACTTGGTCGGACTAAACAGCTGCAATACTGGTTTCTCTT
JMSF048A09+ TAACAACCTCTTCAACAAAGTACTTGGTCGGACTAAACAGCTGCAATACTGGTTTCTCTT
                      ____________________________________________________________
consensus TAACAACCTCTTCAACAAAGTACTTGGTCGGACTAAACAGCTGCAATACTGGTTTCTCTT
 
. : . : . : . : . : . :
JMFS084B08+ TCTGGGCCTGGAAAAGCTTTTCAGACATGAACTTCTCATCAAACTTGCTGCTGAATATTG
JMFS033E05+ TCTGGGCCTGGAAAAGCTTTTCAGACATGAACTTCTCATCAAACTTGCTGCTGAATATTG
JMFS139F11+ TCTGGGCCTGGAAAAGCTTTTCAGACATGAACTTCTCATCAAACTTGCTGCTGAATATTG
JMFS044E09+ TCTGGGCCTGGAAAAGCTTTTCAGACATGAACTTCTCATCAAACTTGCTGCTGAATATTG
JMFS004A06+ TNTGGGCCTGGAAAAGCTTTTCAGACATGAACTTCTCATCAAACTTGCTGCTGAATATTG
JMSF048A09+ TCTGGGCCTGGAAAAGCTTTTCAGACATGAACTTCTCATCAAACTTGCTGCTGAATATTG
                      ____________________________________________________________
consensus TCTGGGCCTGGAAAAGCTTTTCAGACATGAACTTCTCATCAAACTTGCTGCTGAATATTG
 
. : . : . : . : . : . :
JMFS084B08+ TTTTCTTGAAGCTCTCCATCTTCCTGCTCCTCTCCTCGCCGCCTCGCCCGCCATTTTTGT
JMFS033E05+ TTTTCTTGAAGCTCTCCATCTTCCTGCTCCTCTCCTCGCCGCCTCGCCCGCCATTTTTGT
JMFS139F11+ TTTTCTTGAAGCTCTCCATCTTCCTGCTCCTCTCCTCGCCGCCTCGCCCGCCATTTTTGT
JMFS044E09+ TTTTCTTGAAGCTCTCCATCTTCCTGCTCCTCTCCTCGCCGCCTCGCCCGCCATTTTTGT
JMFS004A06+ TTTTCTTGAAGCTCTCCATCTTCCTGCTCCTCTCCTCGCCGCCTCGCCCGCCATTTTTGT
JMSF048A09+ TTTTCTTGAAGCTCTCCATCTTCCTGCTCCTCTCCTCGCCGCCTCGCCCGCCATTTTTGT
                      ____________________________________________________________
consensus TTTTCTTGAAGCTCTCCATCTTCCTGCTCCTCTCCTCGCCGCCTCGCCCGCCATTTTTGT
 
. : . : . : . : . : . :
JMFS084B08+ CCGCTCCCACGTCCAAAATCGCCTCCAAGTACCCGTTAAGCCAATCATTTTCCGCCATTT
JMFS033E05+ CCGCTCCCACGTCCAAAATCGCCTCCAAGTACCCGTTAAGCCAATCATTTTCCGCCATTT
JMFS139F11+ CCGCTCCCACGTCCAAAATCGCCTCCAAGTACCCGTTAAGCCAATCATTTTCCGCCATTT
JMFS044E09+ CCGCTCCCACGTCCAAAATCGCCTCCAAGTACCCGTTAAGCCAATCATTTTCCGCCATTT
JMFS004A06+ CCGCTCCCACGTCCAAAATCGCCTCCCAGTACCCGTTAAGCCAATCATTTTCCGCCATTT
JMSF048A09+ CCGCTCCCACGTCCAAAATCGCCTCCAAGTACCCGTTAAGCCAATCATTTTCCGCCATTT
                      ____________________________________________________________
consensus CCGCTCCCACGTCCAAAATCGCCTCCAAGTACCCGTTAAGCCAATCATTTTCCGCCATTT
 
. : . : . : . : . : . :
JMFS084B08+ CTCTCTTTTCCTTCCCGGTTTTAAGATTTTGTATAGTAAAGATGGCAAGAAAATAAACAG
JMFS033E05+ CTCTCTTTTCCTTCCCGGTTTTAAGATTTTGTATAGTAAAGATGGCAAGAAAATAAACAG
JMFS139F11+ CTCTCTTTTCCTTCCCGGTTTTAAGATTTTGTATAGTAAAGATGGCAAGAAAATAAACAG
JMFS044E09+ CTCTCTTTTCCTTCCCGGTTTTAAGATTTTGTATAGTAAAGATGGCAAGAAAATAAACAG
JMFS004A06+ CTCTCTTTTCCTTCCCGGTTTTAAGATTTTGTATAGTAAAGATGGCAAGAAAATAAACAG
JMSF048A09+ CTCTCTTTTCCTTCCCGGTTTTAAGATTTTGTATAGTAAAGATGGCAAGAAAATAAACAG
                      ____________________________________________________________
consensus CTCTCTTTTCCTTCCCGGTTTTAAGATTTTGTATAGTAAAGATGGCAAGAAAATAAACAG
 
. : . : . : . : . : . :
JMFS084B08+ AAGACTGGGAAGAAGCTTAATTGGAACTAAGAAA
JMFS033E05+ AAGACTGGGAAGAAGCTT-ATTGGAACTAAGAAAGAA
JMFS139F11+ AAGACTGGGAAGAAGCTT-ATTGGAACTAAGAAAGAA
JMFS044E09+ AAGACTGGGAAGAAGCTTAA-TGGAACTAAGAAAGAA
JMFS004A06+ AAGACTGGGAAGAAGCTTAATTGGAACTAAGAAAGAA
JMSF048A09+ AAGACTGGGAAGAAGCTTAATTGGAACTAAGAAAGAATATTGTTTTGTGGTTCGAAACTC
                      ____________________________________________________________
consensus AAGACTGGGAAGAAGCTTAATTGGAACTAAGAAAGAATATTGTTTTGTGGTTCGAAACTC