Previous Contig 007817:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS073C10Sequence627007817 (3)pir|F84730|F847301e-41probable myosin heavy chain [imported] - Arabidopsis thaliana
JMFS104E02Sequence568007817 (3)pir|F84730|F847302e-36probable myosin heavy chain [imported] - Arabidopsis thaliana
JMSF047P15Sequence637007817 (3)pir|F84730|F847306e-22probable myosin heavy chain [imported] - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS104E02+ ACTTGCTCCTTTGTGTTAACTTCCTCCTCCAGCTTCAACTTGAGTGCCTCCTCAGC
JMFS073C10+ TCAACTTGAGTGCCTCCTCAGC
                      ____________________________________________________________
consensus ACTTGCTCCTTTGTGTTAACTTCCTCCTCCAGCTTCAACTTGAGTGCCTCCTCAGC
 
. : . : . : . : . : . :
JMFS104E02+ CCTCTCCCCTTCAGCAGTCTTCTCAGAAAGGACTTTAAGCTCTGCCTGCAAAGAAGCCAT
JMFS073C10+ CCTCTCCCCTTCAGCAGTCTTCTCAGAAAGGACTTTAAGCTCTGCCTGCAAAGAAGCCAT
                      ____________________________________________________________
consensus CCTCTCCCCTTCAGCAGTCTTCTCAGAAAGGACTTTAAGCTCTGCCTGCAAAGAAGCCAT
 
. : . : . : . : . : . :
JMFS104E02+ CTGGTCTTCCATTTCTTTTGCACTTAATTTTGACTGCTCAAGCAACCTCTCGAATTCCGA
JMFS073C10+ CTGGTCTTCCATTTCTTTTGCACTTAATTTTGACTGCTCAAGCAACCTCTCGAATTCCGA
                      ____________________________________________________________
consensus CTGGTCTTCCATTTCTTTTGCACTTAATTTTGACTGCTCAAGCAACCTCTCGAATTCCGA
 
. : . : . : . : . : . :
JMFS104E02+ GGCCCTCTTTGTCTCTGACTCTGCAAGTGAACCACTTTGCAAGTGCAATTCCTCAAACTT
JMFS073C10+ GGCCCTCTTTGTCTCTGACTCTGCAAGTGAACCACTTTGCAAGTGCAATTCCTCAAACTT
                      ____________________________________________________________
consensus GGCCCTCTTTGTCTCTGACTCTGCAAGTGAACCACTTTGCAAGTGCAATTCCTCAAACTT
 
. : . : . : . : . : . :
JMFS104E02+ TCGGGACTCACCAACTGAAGTTTGCAGCTCCTGCTCAAGCTCTTCTCTCTTCTTTTTTGA
JMFS073C10+ TCGGGACTCACCAACTGAAGTTTGCAGCTCCTGCTCAAGCTCTTCTCTCTTCTTTTTTGA
                      ____________________________________________________________
consensus TCGGGACTCACCAACTGAAGTTTGCAGCTCCTGCTCAAGCTCTTCTCTCTTCTTTTTTGA
 
. : . : . : . : . : . :
JMFS104E02+ GCTGTCAAACTCGAGGCTAAGTCTTTCAAATGCTTCCTTGACACTTTCAAGTTCCTTGTG
JMFS073C10+ GCTGTCAAACTCGAGGCTAAGTCTTTCAAATGCTTCCTTGACACTTTCAAGTTCCTTGTG
JMSF047P15+ TTTCAAATGCTTCCTTGACACTTTCAAGTTCCTTGTG
                      ____________________________________________________________
consensus GCTGTCAAACTCGAGGCTAAGTCTTTCAAATGCTTCCTTGACACTTTCAAGTTCCTTGTG
 
. : . : . : . : . : . :
JMFS104E02+ CTTTACTTCTCCAGCATGTATAGCATCCTGCAAGGCACTGAGCTGGGCACTATATCTCCC
JMFS073C10+ CTTTACTTCTCCAGCATGTATAGCATCCTGCAAGGCACTGAGCTGGGCACTATATCTCCC
JMSF047P15+ CTTTACTTCTCCAGCATGTATAGCATCCTGCAAGGCACTGAGCTGGGCACTATATCTCCC
                      ____________________________________________________________
consensus CTTTACTTCTCCAGCATGTATAGCATCCTGCAAGGCACTGAGCTGGGCACTATATCTCCC
 
. : . : . : . : . : . :
JMFS104E02+ TTCTTCCTCTGCAATCTGTTGTTGCAACTTCTTATGACTAATTTCAAGATCTTCATACTT
JMFS073C10+ TTCTTCCTCTGCAATCTGTTGTTGCAACTTCTTATGACTAATTTCAAGATCTTCATACTT
JMSF047P15+ TTCTTCCTCTGCAATCTGTTGTTGCAACTTCTTATGACTAATTTCAAGATCTTCATACTT
                      ____________________________________________________________
consensus TTCTTCCTCTGCAATCTGTTGTTGCAACTTCTTATGACTAATTTCAAGATCTTCATACTT
 
. : . : . : . : . : . :
JMFS104E02+ TTTTCCAATCTCCCCTAGCTTCTCTTTTGTGAGTGAGAGTTCATCATTCAACTGATCATT
JMFS073C10+ TTTTCCAATCTCCCCTAGCTTCTCTTTTGTGAGTGAGAGTTCATCATTCAACTGATCATT
JMSF047P15+ TTTTCCAATCTCCCCTAGCTTCTCTTTTGTGAGTGAGAGTTCATCATTCAACTGATCATT
                      ____________________________________________________________
consensus TTTTCCAATCTCCCCTAGCTTCTCTTTTGTGAGTGAGAGTTCATCATTCAACTGATCATT
 
. : . : . : . : . : . :
JMFS104E02+ TCGAGATTCAGAATCCTTTAATGATCCCATGA
JMFS073C10+ TCGAGATTCAGAATCCTTTAATGATCCCATGACTCTTTCCATTTCCACCTCAAGCTCTCT
JMSF047P15+ TCGAGATTCAGAATCCTTTAATGATCCCATGACTCTTTCCATTTCCACCTCAAGCTCTCT
                      ____________________________________________________________
consensus TCGAGATTCAGAATCCTTTAATGATCCCATGACTCTTTCCATTTCCACCTCAAGCTCTCT
 
. : . : . : . : . : . :
JMFS073C10+ AACCTTTTCTTGGGATTCCAGAAACTCCCTGCTTGCAGATGAAAGGCTCACGACATTTTG
JMSF047P15+ AACCTTTTCTTGGGATTCCAGAAACTCCCTGCTTGCAGATGAAAGGCTCACGACATTTTG
                      ____________________________________________________________
consensus AACCTTTTCTTGGGATTCCAGAAACTCCCTGCTTGCAGATGAAAGGCTCACGACATTTTG
 
. : . : . : . : . : . :
JMFS073C10+ AGAAG
JMSF047P15+ AGAAGCTGTATTTTCGGTAGCAGTATGTGCGACATCCTTTGATTCAAGAGTTTCTTTCTC
                      ____________________________________________________________
consensus AGAAGCTGTATTTTCGGTAGCAGTATGTGCGACATCCTTTGATTCAAGAGTTTCTTTCTC
 
. : . : . : . : . : . :
JMSF047P15+ TACTTTTATGAATTCACCGTCAAAACCAGTTTCTTCTTCTTCTTCTTTCTTTCCTACCTT
                      ____________________________________________________________
consensus TACTTTTATGAATTCACCGTCAAAACCAGTTTCTTCTTCTTCTTCTTTCTTTCCTACCTT
 
. : . : . : . : . : . :
JMSF047P15+ CTCTGTCACCTTAATCGGGTCAGCTTTGCTGTCTTTGTCCTCTGCAACCTTTGAAATTGG
                      ____________________________________________________________
consensus CTCTGTCACCTTAATCGGGTCAGCTTTGCTGTCTTTGTCCTCTGCAACCTTTGAAATTGG
 
. : . : . : . : . : . :
JMSF047P15+ TATATCAGGATCTAATTGAATCTCTGCTTCCATTACAAAATGAATGTTGCCTTCTGACTA
                      ____________________________________________________________
consensus TATATCAGGATCTAATTGAATCTCTGCTTCCATTACAAAATGAATGTTGCCTTCTGACTA
 
. : . : . : . : . : . :
JMSF047P15+ ATGAACCTTTCCAGCAATCTGATCAAAGTAGCCGCAACAACGATGATATCGATCCGATTC
                      ____________________________________________________________
consensus ATGAACCTTTCCAGCAATCTGATCAAAGTAGCCGCAACAACGATGATATCGATCCGATTC