Previous Contig 007814:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037N06Sequence661007814 (3)gb:AY102147_15777522e-45Arabidopsis thaliana At1g68400/T2E12_5 mRNA, complete cds.>gb:AF378890_1793475 A
JMSF044F10Sequence753007814 (3)gb:AY102147_15777521e-54Arabidopsis thaliana At1g68400/T2E12_5 mRNA, complete cds.>gb:AF378890_1793475 A775024092gb:AY102147_1577752e-110Arabidopsis thaliana At1g68400/T2E12_5 mRNA, complete cds.>gb:AF378890_1793475 A
JMSF047P01Sequence602007814 (3)gb:AY102147_15777529e-33Arabidopsis thaliana At1g68400/T2E12_5 mRNA, complete cds.>gb:AF378890_1793475 A149024283

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044F10+ CGGTAACCCGCGAGCATTTCGGCAAAGGAGGCCCGCAAAGAACGG
                      ____________________________________________________________
consensus CGGTAACCCGCGAGCATTTCGGCAAAGGAGGCCCGCAAAGAACGG
 
. : . : . : . : . : . :
JMSF037N06+ CCAGAGAGAGAAGCGGGTATCTCCCCAACAA
JMSF044F10+ GGTTGTTGGCGAATGAGGATTCGGGGAAACCAGAGAGAGAAGCGGGTATCTCCCCAACAA
                      ____________________________________________________________
consensus GGTTGTTGGCGAATGAGGATTCGGGGAAACCAGAGAGAGAAGCGGGTATCTCCCCAACAA
 
. : . : . : . : . : . :
JMSF037N06+ GTCTGTTCCCGGAGACGTTGAAGTCCTGGAGATTCGGGAGGTTGACGCCGGAAATCGAAC
JMSF044F10+ GTCTGTTCCCGGAGACGTTGAAGTCCTGGAGATTCGGGAGGTTGACGCCGGAAATCGAAC
                      ____________________________________________________________
consensus GTCTGTTCCCGGAGACGTTGAAGTCCTGGAGATTCGGGAGGTTGACGCCGGAAATCGAAC
 
. : . : . : . : . : . :
JMSF037N06+ CGGAGAACCCGTTTTCCTCGAGGCGCAGGGTGAGCAGATGAGTCAAATGGCTCGCACTCG
JMSF044F10+ CGGAGAACCCGTTTTCCTCGAGGCGCAGGGTGAGCAGATGAGTCAAATGGCTCGCACTCG
JMSF047P01+ CG
                      ____________________________________________________________
consensus CGGAGAACCCGTTTTCCTCGAGGCGCAGGGTGAGCAGATGAGTCAAATGGCTCGCACTCG
 
. : . : . : . : . : . :
JMSF037N06+ CCGGAATCTCACCGGAGAAATTATTATGCGACAGATCAAGCCTGTACAGCCTGAACAACG
JMSF044F10+ CCGGAATCTCACCGGAGAAATTATTATGCGACAGATCAAGCCTGTACAGCCTGAACAACG
JMSF047P01+ CCGGAATCTCACCGGAGAAATTATTATGCGACAGATCAAGCCTGTACAGCCTGAACAACG
                      ____________________________________________________________
consensus CCGGAATCTCACCGGAGAAATTATTATGCGACAGATCAAGCCTGTACAGCCTGAACAACG
 
. : . : . : . : . : . :
JMSF037N06+ ACGTCAGAGACGCCGGAAACTCGCCCGAGAGCTCATTGTACGAAAGAAACAACAGCTTCA
JMSF044F10+ ACGTCAGAGACGCCGGAAACTCGCCCGAGAGCTCATTGTACGAAAGAAACAACAGCTTCA
JMSF047P01+ ACGTCAGAGACGCCGGAAACTCGCCCGAGAGCTCATTGTACGAAAGAAACAACAGCTTCA
                      ____________________________________________________________
consensus ACGTCAGAGACGCCGGAAACTCGCCCGAGAGCTCATTGTACGAAAGAAACAACAGCTTCA
 
. : . : . : . : . : . :
JMSF037N06+ GTGCAGTGAGCTTAGAAAGGTCGGGGAGAGGACCCGTGAACCGGTTCCACTTGAGACTGA
JMSF044F10+ GTGCAGTGAGCTTAGAAAGGTCGGGGAGAGGACCCGTGAACCGGTTCCACTTGAGACTGA
JMSF047P01+ GTGCAGTGAGCTTAGAAAGGTCGGGGAGAGGACCCGTGAACCGGTTCCACTTGAGACTGA
                      ____________________________________________________________
consensus GTGCAGTGAGCTTAGAAAGGTCGGGGAGAGGACCCGTGAACCGGTTCCACTTGAGACTGA
 
. : . : . : . : . : . :
JMSF037N06+ GAACCCGGAGCTGGGTGAGCGAACTAAGCTGCTGAAACGAGCCATGGAGGTCGAAACCTT
JMSF044F10+ GAACCCGGAGCTGGGTGAGCGAACTAAGCTGCTGAAACGAGCCATGGAGGTCGAAACCTT
JMSF047P01+ GAACCCGGAGCTGGGTGAGCGAACTAAGCTGCTGAAACGAGCCATGGAGGTCGAAACCTT
                      ____________________________________________________________
consensus GAACCCGGAGCTGGGTGAGCGAACTAAGCTGCTGAAACGAGCCATGGAGGTCGAAACCTT
 
. : . : . : . : . : . :
JMSF037N06+ CAAGAACGAGGCGAGAAACCCGGTTGTTTTGGCAAGAAACACCAGTCCACCCACACAGGT
JMSF044F10+ CAAGAACGAGGCGAGAAACCCGGTTGTTTTGGCAAGAAACACCAGTCCACCCACACAGGT
JMSF047P01+ CAAGAACGAGGCGAGAAACCCGGTTGTTTTGGCAAGAAACACCAGTCCACCCACACAGGT
                      ____________________________________________________________
consensus CAAGAACGAGGCGAGAAACCCGGTTGTTTTGGCAAGAAACACCAGTCCACCCACACAGGT
 
. : . : . : . : . : . :
JMSF037N06+ CGGAGCTGGAGTTCCAATCCCACAGCTTATTAGAAGTGTCCACAGCGGCTTTGAAGGACA
JMSF044F10+ CGGAGCTGGAGTTCCAATCCCACAGCTTATTAGAAGTGTCCACAGCGGCTTTGAAGGACA
JMSF047P01+ CGGAGCTGGAGTTCCAATCCCNCAGCTTATTAGAAGTGTCCACAGCGGCTTTGAAGGACA
                      ____________________________________________________________
consensus CGGAGCTGGAGTTCCAATCCCACAGCTTATTAGAAGTGTCCACAGCGGCTTTGAAGGACA
 
. : . : . : . : . : . :
JMSF037N06+ GCAACGTCTCAGCGTCTGGGTTTGAAGCAGCGTTTAGGAAGGAGAAATGGAAGAGAATGA
JMSF044F10+ GCAACGTCTCAGCGTCTGGGTTTGAAGCAGCGTTTAGGAAGGAGAAATGGAAGAGAATGA
JMSF047P01+ GCAACGTCTCAGCGTCTGGGTTTGAAGCAGCGTTTAGGAAGGAGAAATGGAAGAGAATGA
                      ____________________________________________________________
consensus GCAACGTCTCAGCGTCTGGGTTTGAAGCAGCGTTTAGGAAGGAGAAATGGAAGAGAATGA
 
. : . : . : . : . : . :
JMSF037N06+ GAAGCAAGAGATAGAGAGATAAATGCAGTAGCGTTCTCAGTCTCGCCATTGTAGAGAGAG
JMSF044F10+ GAAGCAAGAGATAGAGAGATAAATGCAGTAGCGTTCTCAGTCTCGCCATTGTAGAGAGAG
JMSF047P01+ GAAGCAAGAGATAGAGAGATAAATGCAGTAGCGTTCTCAGTCTCGCCATTGTAGAGAGAG
                      ____________________________________________________________
consensus GAAGCAAGAGATAGAGAGATAAATGCAGTAGCGTTCTCAGTCTCGCCATTGTAGAGAGAG
 
. : . : . : . : . : . :
JMSF037N06+ AAGGTGAAGGTGGAGAAGAAATGGCGT
JMSF044F10+ AAGGTGAAGGTGGAGAAGAAATGGCGTATGGAGGGAGGGAGCAGG
JMSF047P01+ AAGGTGAAGGTGGAGAAGAAATGGCGTATGGAGGGAGGGAGCAGGTTGAAGGGTGAAGAA
                      ____________________________________________________________
consensus AAGGTGAAGGTGGAGAAGAAATGGCGTATGGAGGGAGGGAGCAGGTTGAAGGGTGAAGAA
 
. : . : . : . : . : . :
JMSF047P01+ AGAGGGTTAAGAGTGTAATTAATGCAAAAGCAATGGGACAATTGGTGAATAATAAATGCC
                      ____________________________________________________________
consensus AGAGGGTTAAGAGTGTAATTAATGCAAAAGCAATGGGACAATTGGTGAATAATAAATGCC