Previous Contig 007812:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002O02Sequence296007812 (2)754013748 (2)gb:BT002752_16363554e-30Arabidopsis thaliana clone C104851 putative protein kinase (At5g14720) mRNA, com
JMSF047O11Sequence705007812 (2)gb:AY065426_15665321e-11Arabidopsis thaliana putative protein kinase (At5g14720) mRNA, complete cds.732013748 (2)gb:BT002752_16363552e-27Arabidopsis thaliana clone C104851 putative protein kinase (At5g14720) mRNA, com

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047O11+ CTCATTAAGTGGAATGCACAGAGCTCTGTACACAATGGCACTCAC
                      ____________________________________________________________
consensus CTCATTAAGTGGAATGCACAGAGCTCTGTACACAATGGCACTCAC
 
. : . : . : . : . : . :
JMSF047O11+ ACCTTCTCCAACTTCCTCATATAATTCATAATCCTTGGCATTAACAGGGAACTTTTTCTC
                      ____________________________________________________________
consensus ACCTTCTCCAACTTCCTCATATAATTCATAATCCTTGGCATTAACAGGGAACTTTTTCTC
 
. : . : . : . : . : . :
JMSF047O11+ TGAGCTTCCTTCCATGGTTTCTTCTTATGCCACGGCATAAAATGCCCTTTCTACCTAGTG
                      ____________________________________________________________
consensus TGAGCTTCCTTCCATGGTTTCTTCTTATGCCACGGCATAAAATGCCCTTTCTACCTAGTG
 
. : . : . : . : . : . :
JMSF047O11+ TTCTCAAAGAAAATGTGAGCAGGGTGTTGGAAAAGGAGGCTAGGGTAAAAATGCATGATG
                      ____________________________________________________________
consensus TTCTCAAAGAAAATGTGAGCAGGGTGTTGGAAAAGGAGGCTAGGGTAAAAATGCATGATG
 
. : . : . : . : . : . :
JMSF047O11+ TTTCTTCCAACTGCATACCATTCTACAGAGTGTTTGCATGGCTCAAGCTAGGATCTACTA
                      ____________________________________________________________
consensus TTTCTTCCAACTGCATACCATTCTACAGAGTGTTTGCATGGCTCAAGCTAGGATCTACTA
 
. : . : . : . : . : . :
JMSF047O11+ AGAAAATTTCTAATTAAGAATACAGTGGATGATGATCTCAGCAGAGTTAACAGTTTCACC
                      ____________________________________________________________
consensus AGAAAATTTCTAATTAAGAATACAGTGGATGATGATCTCAGCAGAGTTAACAGTTTCACC
 
. : . : . : . : . : . :
JMSF002O02+ CAAGTTGGCAACTGATTATTTGATGTCTAGCGGAGCCTGCCTTGATTATCACCAGATAAG
JMSF047O11+ CAAGTTGGCAACTGATTATTTGATGTCTAGCGGAGCCTGCCTTGATTATCACCAGATAAG
                      ____________________________________________________________
consensus CAAGTTGGCAACTGATTATTTGATGTCTAGCGGAGCCTGCCTTGATTATCACCAGATAAG
 
. : . : . : . : . : . :
JMSF002O02+ TTGGGAAGCCACTCCTGAATGCTCTCACATCAACTCTTCAATTGATATTTATGTGGCAGT
JMSF047O11+ TTGGGAAGCCACTCCTGAATGCTCTCACATCAACTCTTCAATTGATATTTATGTGGCAGT
                      ____________________________________________________________
consensus TTGGGAAGCCACTCCTGAATGCTCTCACATCAACTCTTCAATTGATATTTATGTGGCAGT
 
. : . : . : . : . : . :
JMSF002O02+ CAGTTCAACCAGATCTCTGCCAGTATCCTCCGAAGAAAACAGTCCCCCTAGGGTTTCGAG
JMSF047O11+ CAGTTCAACCAGATCTCTGCCAGTATCCTCCGAAGAAAACAGTCCCCCTAGGGTTTCGAG
                      ____________________________________________________________
consensus CAGTTCAACCAGATCTCTGCCAGTATCCTCCGAAGAAAACAGTCCCCCTAGGGTTTCGAG
 
. : . : . : . : . : . :
JMSF002O02+ ATCAGGCAAGAACTCCGAGAAGAACTGAATCTGGCAGAGAAAGAAGCTAGAGGTTCAAAC
JMSF047O11+ ATCAGGCAAGAACTCCGAGAAGAACTGAATCTGGCAGAGAAAGAAGCTAGAGGTTCAAAC
                      ____________________________________________________________
consensus ATCAGGCAAGAACTCCGAGAAGAACTGAATCTGGCAGAGAAAGAAGCTAGAGGTTCAAAC
 
. : . : . : . : . : . :
JMSF002O02+ GTCGCCGTTTTAGCTGGTGATGAAAAGCCTTTGTACTATTCCGCCATGGACGAGT
JMSF047O11+ GTCGCCGTTTTAGCTGGTGATGAAAAGCCTTTGTACTATTCCGCCATGGACGAGTGTGTA
                      ____________________________________________________________
consensus GTCGCCGTTTTAGCTGGTGATGAAAAGCCTTTGTACTATTCCGCCATGGACGAGTGTGTA
 
. : . : . : . : . : . :
JMSF047O11+ TTTAGAAATCTAGAATCAACAGATACAGTTCTCACTTCTTCCCTCGTAGTTAGCCGTCCC
                      ____________________________________________________________
consensus TTTAGAAATCTAGAATCAACAGATACAGTTCTCACTTCTTCCCTCGTAGTTAGCCGTCCC