Previous Contig 007809:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS030E03Sequence611007809 (4)gb:AC084218_17333809e-18Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07, complete seq
JMFS066H09Sequence642007809 (4)gb:AC084218_17333801e-17Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07, complete seq
JMFS072B12Sequence635007809 (4)gb:AC084218_17333802e-12Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07, complete seq
JMSF047N17Sequence643007809 (4)gb:AC084218_17333808e-10Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07, complete seq709013744 (2)gb:AC084218_17333808e-70Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS030E03+ TCAGAATCCATGCCAGAATCCAAAATAAGCTGGGCCCGGCGGGAACTGATTTCTCC
JMFS066H09+ TAAGCTGGGCCCGGCGGGAACTGATTTCTCC
                      ____________________________________________________________
consensus TCAGAATCCATGCCAGAATCCAAAATAAGCTGGGCCCGGCGGGAACTGATTTCTCC
 
. : . : . : . : . : . :
JMFS030E03+ CACACGCAACAGTGCTACAGCCAAATCCAACAAGGTGGCGGACGAAACCTTGGCAGCCGC
JMFS066H09+ CACACGCAACAGTGCTACAGCCAAATCCAACAAGGTGGCGGACGAAACCTTGGCAGCCGC
                      ____________________________________________________________
consensus CACACGCAACAGTGCTACAGCCAAATCCAACAAGGTGGCGGACGAAACCTTGGCAGCCGC
 
. : . : . : . : . : . :
JMFS030E03+ GGAGGAGCTAGCTCTGAAGGCAGAATTGAGCTGAGTCCTAGTCCTGGAGTGCAGGAGGCG
JMFS066H09+ GGAGGAGCTAGCTCTGAAGGCAGAATTGAGCTGAGTCCTAGTCCTGGAGTGCAGGAGGCG
                      ____________________________________________________________
consensus GGAGGAGCTAGCTCTGAAGGCAGAATTGAGCTGAGTCCTAGTCCTGGAGTGCAGGAGGCG
 
. : . : . : . : . : . :
JMFS030E03+ GCAAATCTCCTTGAAGTGACCGTGAACCTCAGGAATATCATAAACTGAAGGATCAAGCGG
JMFS066H09+ GCAAATCTCCTTGAAGTGACCGTGAACCTCAGGAATATCATAAACTGAAGGATCAAGCGG
JMFS072B12+ ACCGTGAACCTCAGGAATATCATAAACTGAAGGATCAAGCGG
                      ____________________________________________________________
consensus GCAAATCTCCTTGAAGTGACCGTGAACCTCAGGAATATCATAAACTGAAGGATCAAGCGG
 
. : . : . : . : . : . :
JMFS030E03+ ACTTCCGCCCACCATTTTAGAGCCGTTGAGGAAGACCTTAATGGCAGCAGCCACCGAAAC
JMFS066H09+ ACTTCCGCCCACCATTTTAGAGCCGTTGAGGAAGACCTTAATGGCAGCAGCCACCGAAAC
JMFS072B12+ ACTTCCGCCCACCATTTTAGAGCCGTTGAGGAAGACCTTAATGGCAGCAGCCACCGAAAC
JMSF047N17+ TAGAGCCGTTGAGGAAGACCTTAATGGCAGCAGCCACCGAAAC
                      ____________________________________________________________
consensus ACTTCCGCCCACCATTTTAGAGCCGTTGAGGAAGACCTTAATGGCAGCAGCCACCGAAAC
 
. : . : . : . : . : . :
JMFS030E03+ GTCATCCTTGGCAGTGGAACCATCCCCTGAGTCGATCAAATCGAAAGCGGATACATCGGC
JMFS066H09+ GTCATCCTTGGCAGTGGAACCATCCCCTGAGTCGATCAAATCGAAAGCGGATACATCGGC
JMFS072B12+ GTCATCCTTGGCAGTGGAACCATCCCCTGAGTCGATCAAATCGAAAGCGGATACATCGGC
JMSF047N17+ GTCATCCTTGGCAGTGGAACCATCCCCTGAGTCGATCAAATCGAAAGCGGATACATCGGC
                      ____________________________________________________________
consensus GTCATCCTTGGCAGTGGAACCATCCCCTGAGTCGATCAAATCGAAAGCGGATACATCGGC
 
. : . : . : . : . : . :
JMFS030E03+ CTTCAAGGCCTCGCAGGACAGAGCAGCAACAGCATCGGAAATCAATGACAAAGCCGAACA
JMFS066H09+ CTTCAAGGCCTCGCAGGACAGAGCAGCAACAGCATCGGAAATCAATGACAAAGCCGAACA
JMFS072B12+ CTTCAAGGCCTCGCAGGACAGAGCAGCAACAGCATCGGAAATCAATGACAAAGCCGAACA
JMSF047N17+ CTTCAAGGCCTCGCAGGACAGAGCAGCAACAGCATCGGAAATCAATGACAAAGCCGAACA
                      ____________________________________________________________
consensus CTTCAAGGCCTCGCAGGACAGAGCAGCAACAGCATCGGAAATCAATGACAAAGCCGAACA
 
. : . : . : . : . : . :
JMFS030E03+ GCGGTGGTCGGCGAGGGCGGAAACACCAACTAGTACGGACAATGGAAAATCGAGGGAAGG
JMFS066H09+ GCGGTGGTCGGCGAGGGCGGAAACACCAACTAGTACGGACAATGGAAAATCGAGGGAAGG
JMFS072B12+ GCGGTGGTCGGCGAGGGCGGAAACACCAACTAGTACGGACAATGGAAAATCGAGGGAAGG
JMSF047N17+ GCGGTGGTCGGCGAGGGCGGAAACACCAACTAGTACGGACAATGGAAAATCGAGGGAAGG
                      ____________________________________________________________
consensus GCGGTGGTCGGCGAGGGCGGAAACACCAACTAGTACGGACAATGGAAAATCGAGGGAAGG
 
. : . : . : . : . : . :
JMFS030E03+ GAGAACCGCCGGGGCAATACCGTCAATAGCAATATTAGCATCACTACTACTTTCACTATT
JMFS066H09+ GAGAACCGCCGGGGCAATACCGTCAATAGCAATATTAGCATCACTACTACTTTCACTATT
JMFS072B12+ GAGAACCGCCGGGGCAATACCGTCAATAGCAATATTAGCATCACTACTACTTTCACTATT
JMSF047N17+ GAGAACCGCCGGGGCAATACCGTCAATAGCAATATTAGCATCACTACTACTTTCACTATT
                      ____________________________________________________________
consensus GAGAACCGCCGGGGCAATACCGTCAATAGCAATATTAGCATCACTACTACTTTCACTATT
 
. : . : . : . : . : . :
JMFS030E03+ GAGGATCTCGGAGAGCTGACCTGCAGCCGCAACAGATGAAGAGGAAGTAAGCAATAGCTT
JMFS066H09+ GAGGATCTCGGAGAGCTGACCTGCAGCCGCAACAGATGAAGAGGAAGTAAGCAATAGCTT
JMFS072B12+ GAGGATCTCGGAGAGCTGACCTGCAGCCGCAACAGATGAAGAGGAAGTAAGCAATAGCTT
JMSF047N17+ GAGGATCTCGGAGAGCTGACCTGCAGCCGCAACAGATGAAGAGGAAGTAAGCAATAGCTT
                      ____________________________________________________________
consensus GAGGATCTCGGAGAGCTGACCTGCAGCCGCAACAGATGAAGAGGAAGTAAGCAATAGCTT
 
. : . : . : . : . : . :
JMFS030E03+ GTTCAGAAGTACTAA
JMFS066H09+ GTTCAGAAGTACTAATGTTGAAGCTCGGACCTCAGTGGCCGATAACAAGTCGCCGGGAAT
JMFS072B12+ GTTCAGAAGTACTAATGTTGAAGCTCGGACCTCAGTGGCCGATAACAAGTCGCCGGGAAT
JMSF047N17+ GTTCAGAAGTACTAATGTTGAAGCTCGGACCTCAGTGGCCGATAACAAGTCGCCGGGAAT
                      ____________________________________________________________
consensus GTTCAGAAGTACTAATGTTGAAGCTCGGACCTCAGTGGCCGATAACAAGTCGCCGGGAAT
 
. : . : . : . : . : . :
JMFS066H09+ CTGGAAATGGA
JMFS072B12+ CTGGAAATGGAATTTGGCGGCGGCGGGTGACGACGTTTTAGACTTAGCAGCTACGGAAGG
JMSF047N17+ CTGGAAATGGAATTTGGCGGCGGCGGGTGACGACGTTTTAGACTTAGCAGCTACGGAAGG
                      ____________________________________________________________
consensus CTGGAAATGGAATTTGGCGGCGGCGGGTGACGACGTTTTAGACTTAGCAGCTACGGAAGG
 
. : . : . : . : . : . :
JMFS072B12+ AGCAGAAGAATCGATATTCACACGGGCAAGACC-ACATGAGATCTCAACAACGGAGGATG
JMSF047N17+ AGCAGAAGAATCGATATTCACACGGGCAAGACCAACATGAGATCTCAACAACGGAGGATG
                      ____________________________________________________________
consensus AGCAGAAGAATCGATATTCACACGGGCAAGACCAACATGAGATCTCAACAACGGAGGATG
 
. : . : . : . : . : . :
JMFS072B12+ AGGATAGGGATGAACCTTTCCCGCCTACTGTTACGACGCGCTTCTCCATCGCCG
JMSF047N17+ AGGATAGGGATGAACCTTTCCCGCCTACTGTTACGACGCGCTTCTCCATCGCCGCACTAG
                      ____________________________________________________________
consensus AGGATAGGGATGAACCTTTCCCGCCTACTGTTACGACGCGCTTCTCCATCGCCGCACTAG
 
. : . : . : . : . : . :
JMSF047N17+ GGTTGGAGTTTAGCTTAATGCTCTCTCGCCCCCCAGAGAATCTGAAAATGGAAAAAACTC
                      ____________________________________________________________
consensus GGTTGGAGTTTAGCTTAATGCTCTCTCGCCCCCCAGAGAATCTGAAAATGGAAAAAACTC