Previous Contig 007800:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006C10Sequence573007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>711007800 (129)pir|S42552|S425524e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF012C07Sequence468007800 (129)pir|S42552|S425521e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>606007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF013F02Sequence631007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>625007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF019D06Sequence561007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>653007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF019F16Sequence516007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>653007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF037F06Sequence534007800 (129)gb:AB018587_15139753e-19Zea mays ZmGR1a mRNA, complete cds.643007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF038J05Sequence484007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>676007800 (129)pir|S42552|S425524e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF038J06Sequence266001246 (7)pir|T15054|T150544e-37anther-specific protein - wood tobacco>gb:NSCHSLKA1_1691169 Nicotiana sylvestris647007800 (129)pir|S42552|S425522e-27proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF040J13Sequence487007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>530007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF044M04Sequence643007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>599007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFF047H20Sequence606007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>530007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN001C06Sequence503007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN002B06Sequence553007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN003E18Sequence626007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN003K11Sequence608007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN003K20Sequence610007800 (129)pir|S42552|S425522e-27proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN003L06Sequence612007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN004A14Sequence601007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN004H07Sequence617007800 (129)gb:AY100448_15769343e-27Citrus junos clone pBCR4 extensin-like protein (ELP) mRNA, complete cds.
JMFN005D13Sequence615007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN005F10Sequence605007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN005F13Sequence620007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN005L08Sequence498007800 (129)pir|S42552|S425524e-19proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN005L22Sequence449007800 (129)gb:AF248055_17806271e-14Glycine max proline-rich protein mRNA, complete cds.
JMFN006D12Sequence599007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN006F05Sequence618007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN006G12Sequence608007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN006J05Sequence604007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN008H24Sequence627007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN009A08Sequence613007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN009F17Sequence624007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN010I21Sequence596007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN010P23Sequence601007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN011B13Sequence601007800 (129)pir|S42552|S425522e-25proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN011H08Sequence292007800 (129)gb:AB041519_15196795e-08Nicotiana tabacum mRNA for P-rich protein NtEIG-C29, complete cds.
JMFN011J11Sequence590007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN011P12Sequence577007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN012D06Sequence606007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN012J09Sequence642007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN013C02Sequence591007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN013C15Sequence611007800 (129)pir|S42552|S425523e-17proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN013E20Sequence596007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN013H12Sequence416007800 (129)pir|S42552|S425522e-21proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN013L05Sequence612007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN014A03Sequence591007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN014B21Sequence604007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN014F05Sequence589007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN014G01Sequence596007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN014J08Sequence638007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN014J21Sequence605007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN014O03Sequence625007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN015G13Sequence595007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN015J09Sequence406007800 (129)gb:AB018587_15139751e-17Zea mays ZmGR1a mRNA, complete cds.
JMFN015O16Sequence604007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN015P23Sequence602007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN016C03Sequence581007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN016M03Sequence614007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN016M04Sequence595007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN017C23Sequence599007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN017F03Sequence557007800 (129)pir|S42552|S425523e-30proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN017G13Sequence618007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN017I07Sequence597007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN018C14Sequence603007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN018D19Sequence520007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN018M13Sequence598007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN019A09Sequence594007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN025D06Sequence502007800 (129)gb:AB018587_15139753e-18Zea mays ZmGR1a mRNA, complete cds.
JMFN025H03Sequence593007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN028L05Sequence611007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN028M19Sequence439007800 (129)pir|S38378|S383784e-17hypothetical protein - Madagascar periwinkle>gb:CR14KDPP_1648990 C.roseus mRNA f
JMFN028O22Sequence586007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN029C02Sequence502007800 (129)pir|S42552|S425525e-27proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN029I01Sequence587007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN029N23Sequence542007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN031E24Sequence563007800 (129)pir|S42552|S425522e-27proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN031G06Sequence621007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN031H05Sequence558007800 (129)pir|S42552|S425521e-23proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN031H15Sequence576007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN032C04Sequence620007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN032H20Sequence589007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN032O03Sequence570007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN034I19Sequence592007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN035C07Sequence596007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN035G23Sequence175007800 (129)
JMFN035O15Sequence576007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN038A20Sequence628007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN038C21Sequence589007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN038N01Sequence582007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN039C21Sequence596007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN039G24Sequence591007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN039J11Sequence639007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN040A24Sequence628007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN040D03Sequence605007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN040F05Sequence613007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN041D10Sequence593007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN041J08Sequence622007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN041P01Sequence616007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN042E12Sequence607007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN042H03Sequence584007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN042I22Sequence616007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN042J03Sequence596007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN042J13Sequence649007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN042N21Sequence563007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN043F23Sequence584007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN043I06Sequence540007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN043K18Sequence563007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN043P17Sequence590007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN044M11Sequence589007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN046B02Sequence540007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN046E14Sequence484007800 (129)gb:AF248055_17806273e-14Glycine max proline-rich protein mRNA, complete cds.
JMFN046J14Sequence589007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFN046K09Sequence550007800 (129)pir|S42552|S425522e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFS008F10Sequence608007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMFS119B08Sequence602007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMSF015D05Sequence643007800 (129)gb:AJ879072_18151333e-21Capsicum chinense mRNA for extensin-like protein.
JMSF039F06Sequence667007800 (129)pir|S42552|S425523e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>692007800 (129)pir|S42552|S425524e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>
JMSF047L01Sequence678007800 (129)pir|S42552|S425524e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>697007800 (129)pir|S42552|S425524e-29proline-rich protein - rape>gb:A40111_1448841 Sequence 1 from Patent WO9423043.>

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN046E14- GAGAACTAGTCTCG
                      ____________________________________________________________
consensus GAGAACTAGTCTCG
 
. : . : . : . : . : . :
JMFN046E14- AGXXXXXXXXXXXXXXXXXXXXXXXXXGTCACAAAAATATTCTACCACTTTTATTCAACA
JMFN005L08+ CACAAAAATATTCTACCACTTTTATTCAACA
JMFN005L22- CACAAAAATATTCTACCACTTTTATTCAACA
JMFN031H05- CACAAAAATATTCTACCACTTTTATTCAACA
JMFN028O22- ACAAAAATATTCTACCACTTTTATTCAACA
rJMFF044M04- CACAAAAATATTCTACCACTTTTATTCAACA
JMFN017F03+ ACCACTTTTATTCAACA
JMFN031E24- ATTCAACA
JMFN009A08+ CAAAAATATTCTACCACTTTTATTCAACA
JMFN012J09+ TTTTATTCAACA
rJMFF012C07- CTTTTATTC-ACA
rJMFF006C10- CTTTTATTC-ACA
                      ____________________________________________________________
consensus AGNNNNNNNNNNNNNNNNNNNNNNNNNGTCACAAAAATATTCTACCACTTTTATTCAACA
 
. : . : . : . : . : . :
JMFN046E14- CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN005L08+ CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN005L22- CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN031H05- CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN028O22- CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
rJMFF044M04- CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN017F03+ CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN031E24- CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN009A08+ CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN043P17+ CAACAAAGCAAAGTAAGATAT
JMFN012J09+ CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
rJMFF019F16- CTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
rJMFF038J06- AGCANAGTAAGATTA
JMFN042J13+ AAAGCAAAGTAAGATTA
rJMFF038J05- ACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN039J11+ AAAGCAAAGTAAGATTA
JMFN014J08+ CAACAAAGCAAAGTAAGA-TA
rJMSF015D05- AAAATGAACAGTAAATATTACAACAAAGCANAGTAAGATTA
JMFN006F05+ GAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN005F13+ GTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCANAGTAAGATTA
JMFN043I06- ACAAAGCAAAGTAAGATTA
rJMFF047H20- ACAACAAAGCAAAGTAAGATTA
JMFN029C02+ AATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN005D13+ TGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN041J08+ CAACAAAGCAAAGTAAGATTA
JMFS008F10+ AAAGCAAAGTAAGATTA
JMFN014F05+ AGCAAAGTAAGATTA
JMFN032O03+ GCAAAGTAAGATTA
JMFN042N21+ AAGATTA
JMFN003K11+ AAAGCAAAGTAAGATTA
JMFN042E12+ CAAAGCAAAGTAAGATTA
JMFN003K20+ ACAAAGCAAAGTAAGATTA
rJMFF012C07- CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMFN018M13+ AAAGCAAAGTAAGATTA
JMFN017C23+ CAAAGCAAAGTAAGATTA
rJMFF006C10- CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
rJMSF039F06- AAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMSF039F06+ AAGCAAAGTAAGATTA
JMFN041D10+ ACAACAAAGCAAAGTAAGATTA
JMFN025H03+ AAGCAAAGTAAGATTA
JMFN034I19+ ACAACAAAGCAAAGTAAGATTA
JMFN011P12- ACAACAAAGCAAAGTAAGATTA
rJMSF047L01- AAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
JMSF047L01+ ACAACAAAGCAAAGTAAGATTA
                      ____________________________________________________________
consensus CAAAGTTACTGAATAATGAAAAATGAACAGTAAATATTACAACAAAGCAAAGTAAGATTA
 
. : . : . : . : . : . :
JMFN046E14- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN005L08+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN005L22- TCTTAACAATAATCCGACAACACAGTTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN031H05- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN028O22- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF044M04- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN017F03+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN031E24- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN009A08+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN043P17+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN012J09+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF019F16- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF038J06- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN042J13+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF038J05- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN039J11+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN014J08+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN040A24+ ACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN038A20+ ACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMSF015D05- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN041P01+ ACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN040D03+ ACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN008H24+ ACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN016M03+ AACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN040F05+ ATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN004A14+ CAACACAATTACACAAACTGATAAGCTAAGGCANAATAGTGCT
rJMFF040J13- ATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN003E18+ CAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN014O03+ TAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN009F17+ TAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN031G06+ ACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN032C04+ GACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN017G13+ TAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN006F05+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN005F13+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN043I06- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF047H20- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN029C02+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN005D13+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN013L05+ TAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN041J08+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFS008F10+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN014F05+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN032O03+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN043K18+ ACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN042N21+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN003K11+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN042E12+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN004H07+ TAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN003K20+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF012C07- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN018M13+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN017C23+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF006C10- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF013F02- AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN003L06+ AATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN012D06+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN014J21+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN013C15+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN018C14+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFS119B08+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN010P23+ CTGATAAGCTAAGGCAAAATAGTGCT
JMFN029N23+ AAGGCAAAATAGTGCT
JMFN015O16+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFF044M04+ AATAATCCGACACCACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFF047H20+ AAGGCAAAATAGTGCT
JMFN042J03+ AGGCAAAATAGTGCT
JMFN039C21+ AAGGCAAAATAGTGCT
JMFN011B13+ TAAGGCAAAATAGTGCT
JMFN017I07+ AAGGCANAATAGTGCT
JMFN039G24+ AAGGCAAAATAGTGCT
JMFN046J14+ AAGGCAAAATAGTGCT
JMFN043F23+ AAAATAGTGCT
JMFN029I01+ CAAAATAGTGCT
JMFN016C03+ TAGTGCT
JMFN031H15+ GGCAAAATAGTGCT
JMFN018D19+ TAAGGCAAAATAGTGCT
JMFF013F02+ ACACAATTACACAAACTGATAAGNTAAGGCAAAATAGTGCT
JMFN042I22+ ACAATAATCCGACACCACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN006G12+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN005F10+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN006J05+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN028L05+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN006D12+ CTGATAAGCTAAGGCAAAATAGTGCT
JMFN015P23+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN010I21+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN013E20+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN014G01+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN035C07+ AAGGCAAAATAGTGCT
JMFN015G13+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN016M04+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN014B21+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN013C02+ AAGGCAAAATAGTGCT
JMFN014A03+ AAGGCAAAATAGTGCT
JMFN019A09+ AAGGCAAAATAGTGCT
JMFN032H20+ AAGGCAAAATAGTGCT
JMFN038C21+ AAGGCAAAATAGTGCT
JMFN044M11+ AAGGCAAAATAGTGCT
JMFN011J11+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN042H03+ AAGGCAAAATAGTGCT
JMFN038N01+ AAGGCAAAATAGTGCT
JMFN035O15+ AGGCAAAATAGTGCT
JMFN046K09+ AAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN013H12+ TAAGGCAAAATAGTGC-
rJMSF039F06- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF019D06- ATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMFF037F06- ATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMSF039F06+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN041D10+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN025H03+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN034I19+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMFN011P12- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
rJMSF047L01- TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
JMSF047L01+ TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
                      ____________________________________________________________
consensus TCTTAACAATAATCCGACAACACAATTACACAAACTGATAAGCTAAGGCAAAATAGTGCT
 
. : . : . : . : . : . :
JMFN046E14- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN005L08+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN005L22- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACGAC
JMFN031H05- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN028O22- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF044M04- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN017F03+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN031E24- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN009A08+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN043P17+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN012J09+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF019F16- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF038J06- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN042J13+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF038J05- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN039J11+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN014J08+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN040A24+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN038A20+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMSF015D05- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN041P01+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN040D03+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN008H24+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN016M03+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN040F05+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN004A14+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF040J13- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN003E18+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN014O03+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN009F17+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN031G06+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN032C04+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN017G13+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN006F05+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN005F13+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN043I06- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF047H20- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN029C02+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN005D13+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN013L05+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN041J08+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFS008F10+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN014F05+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN032O03+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN043K18+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN042N21+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN003K11+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN042E12+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN004H07+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN003K20+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF012C07- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN018M13+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN017C23+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF006C10- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF013F02- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN003L06+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN012D06+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN014J21+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN013C15+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN018C14+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFS119B08+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN010P23+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN029N23+ TTGCCTACGTAAAAGAGCCTCCTAATAGCGTTAAGAAACAAACAATGGCAATTGTACAAC
JMFN015O16+ TTGCCTACTTAAAAGAACCTCCTAATAGCGTTAAGAAACAAACAATAACAATTGTACAAC
JMFF044M04+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFF047H20+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN042J03+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN039C21+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN011B13+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN017I07+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN039G24+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN046J14+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN043F23+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN029I01+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN016C03+ TTGCCTACTTAAANGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN031H15+ TTGCCTACTTAAAAGAACCTCTTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFF019D06+ GTTAAGAAACAAACAATAACAATTGTACAAC
JMFN002B06+ CGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN046B02+ CTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFF037F06+ AAC
JMFN018D19+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFF019F16+ TAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFF013F02+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN042I22+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN006G12+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN005F10+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN006J05+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN028L05+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN006D12+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN015P23+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN010I21+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN013E20+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN014G01+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN035C07+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN015G13+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN016M04+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN014B21+ TGTCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACATACAATAACAATTGTACAAC
JMFN013C02+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN014A03+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN019A09+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN032H20+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN038C21+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN044M11+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN011J11+ TTGCCTACTTAAAAGAACTTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN042H03+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN038N01+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN035O15+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN046K09+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN001C06+ CTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN013H12+ TTGCCTACTT-AAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMSF039F06- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF019D06- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
rJMFF037F06- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMSF039F06+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN041D10+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN025H03+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFN034I19+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFF040J13+ TGTACAAC
JMFF006C10+ GTTAAGAAACAAACAATAACAATTGTACAAC
JMFN011P12- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMFF038J05+ CAAC
rJMSF047L01- TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
JMSF047L01+ TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
                      ____________________________________________________________
consensus TTGCCTACTTAAAAGAACCTCCTAATAACGTTAAGAAACAAACAATAACAATTGTACAAC
 
. : . : . : . : . : . :
JMFN046E14- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN005L08+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN005L22- ACAGAAGCAGACACCATTAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN031H05- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN028O22- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF044M04- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN017F03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN031E24- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN009A08+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN043P17+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN012J09+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF019F16- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF038J06- ACANAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN042J13+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF038J05- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN039J11+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN014J08+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN040A24+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN038A20+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMSF015D05- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN041P01+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN040D03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN008H24+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN016M03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN040F05+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN004A14+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF040J13- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN003E18+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN014O03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN009F17+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN031G06+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN032C04+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN017G13+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN006F05+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN005F13+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN043I06- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF047H20- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN029C02+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN005D13+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN013L05+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN041J08+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFS008F10+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN014F05+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN032O03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN043K18+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN042N21+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN003K11+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN042E12+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN004H07+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN003K20+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF012C07- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN018M13+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN017C23+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF006C10- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF013F02- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN003L06+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN012D06+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN014J21+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN013C15+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN018C14+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFS119B08+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN010P23+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN029N23+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN015O16+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFF044M04+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFF047H20+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN042J03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN039C21+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN011B13+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN017I07+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN039G24+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN046J14+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN043F23+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN029I01+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN016C03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN031H15+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFF019D06+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN002B06+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN046B02+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN025D06+ CAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFF037F06+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN018D19+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFF019F16+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFF013F02+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN042I22+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN006G12+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN005F10+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN006J05+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN028L05+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN006D12+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN015P23+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN010I21+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN013E20+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN014G01+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN035C07+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN015G13+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN016M04+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN014B21+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN013C02+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN014A03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN019A09+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN032H20+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN038C21+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN044M11+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN011J11+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN042H03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN038N01+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN035O15+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN046K09+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN001C06+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN013H12+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMSF039F06- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF019D06- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMFF037F06- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMSF039F06+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN041D10+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN025H03+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN034I19+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFF040J13+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFF012C07+ CAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN028M19+ GACACCAATATCAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGT
JMFF006C10+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFN011P12- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMFF038J05+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
rJMSF047L01- ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
JMSF047L01+ ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
                      ____________________________________________________________
consensus ACAGAAGCAGACACCAATAACAACAAAATCATGAAAATGAGCCACGGCTAGGTGTGGGGA
 
. : . : . : . : . : . :
JMFN046E14- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN005L08+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN005L22- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN031H05- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN028O22- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF044M04- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN017F03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN031E24- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN009A08+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN043P17+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN012J09+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF019F16- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF038J06- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN042J13+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF038J05- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN039J11+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN014J08+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN040A24+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN038A20+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMSF015D05- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN041P01+ GAAATAATATAATGTTGGCTTAATTATTGGCACTCGAAGCCAGTAGGGACAGTCTTTTGG
JMFN040D03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN008H24+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN016M03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN040F05+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN004A14+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF040J13- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN003E18+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN014O03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN009F17+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN031G06+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN032C04+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN017G13+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN006F05+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN005F13+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN043I06- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF047H20- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN029C02+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN005D13+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN013L05+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN041J08+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFS008F10+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN014F05+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN032O03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN043K18+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN042N21+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN003K11+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN042E12+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN004H07+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAG-GGGGACAGTCTTTTGG
JMFN003K20+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF012C07- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN018M13+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN017C23+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF006C10- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF013F02- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN003L06+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN012D06+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN014J21+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN013C15+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN018C14+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFS119B08+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN010P23+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN029N23+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN015O16+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFF044M04+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFF047H20+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN042J03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN039C21+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN011B13+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTC-TTTGG
JMFN017I07+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN039G24+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN046J14+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN043F23+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN029I01+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN016C03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN031H15+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFF019D06+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN002B06+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN046B02+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN025D06+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFF037F06+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN018D19+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFF019F16+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFF013F02+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN042I22+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN006G12+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN005F10+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN006J05+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN028L05+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN006D12+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN015P23+ GAGATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN010I21+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN013E20+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN014G01+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN035C07+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN015G13+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN016M04+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN014B21+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN013C02+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN014A03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN019A09+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGAACAGTCTTTTGG
JMFN032H20+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN038C21+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN044M11+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN011J11+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN042H03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN038N01+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN035O15+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN046K09+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN001C06+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN013H12+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMSF039F06- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF019D06- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMFF037F06- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMSF039F06+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN041D10+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN025H03+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN034I19+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFF040J13+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFF012C07+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN028M19+ AAAATAATATAATGTTGGCTTAATTGTTGGCACTTAAAGCCAGTAGGGACAGTCTTTTGG
JMFN015J09+ ATATAATGTTGGTTTAATTATTGGCACTTGATGCCAGTAGGGACAGTCTTTTGG
JMFF006C10+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFN011P12- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMFF038J05+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
rJMSF047L01- GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
JMSF047L01+ GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
                      ____________________________________________________________
consensus GAAATAATATAATGTTGGCTTAATTATTGGCACTTGAAGCCAGTAGGGACAGTCTTTTGG
 
. : . : . : . : . : . :
JMFN046E14- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN005L08+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN005L22- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN031H05- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN028O22- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF044M04- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN017F03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN031E24- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN009A08+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN043P17+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN012J09+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF019F16- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF038J06- CANGCACTAACAANAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN042J13+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF038J05- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN039J11+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN014J08+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN040A24+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN038A20+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN011H08+ CAGGTTGATCCCAAGCCCGTTG
rJMSF015D05- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN041P01+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN040D03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN008H24+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN016M03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN040F05+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN004A14+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF040J13- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN003E18+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN014O03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN009F17+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN031G06+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN032C04+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN017G13+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN006F05+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN005F13+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN043I06- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF047H20- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN029C02+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN005D13+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN013L05+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN041J08+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFS008F10+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN014F05+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN032O03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN043K18+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN042N21+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN003K11+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN042E12+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN004H07+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN003K20+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF012C07- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN018M13+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN017C23+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF006C10- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF013F02- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN003L06+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN012D06+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN014J21+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN013C15+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN018C14+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFS119B08+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN010P23+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN029N23+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN015O16+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFF044M04+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFF047H20+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN042J03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN039C21+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN011B13+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN017I07+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN039G24+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN046J14+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN043F23+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN029I01+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN016C03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN031H15+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFF019D06+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN002B06+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN046B02+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN025D06+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFF037F06+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN018D19+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFF019F16+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFF013F02+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN042I22+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN006G12+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN005F10+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN006J05+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN028L05+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN006D12+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN015P23+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN010I21+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN013E20+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN014G01+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN035C07+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN015G13+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN016M04+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN014B21+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN013C02+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN014A03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN019A09+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN032H20+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN038C21+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN044M11+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN011J11+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN042H03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN038N01+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN035O15+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN046K09+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN001C06+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN013H12+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMSF039F06- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF019D06- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMFF037F06- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMSF039F06+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN041D10+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN025H03+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN034I19+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFF040J13+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFF012C07+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN028M19+ CAGGCGCTAACAAGAGCAGTAAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN015J09+ CAGGCACTGACAAGAGCAGTGAGAGCCTCCGGCAGTTCCAGGTTGATCCCAAGCACGTTG
JMFF006C10+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFN011P12- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMFF038J05+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
rJMSF047L01- CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
JMSF047L01+ CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
                      ____________________________________________________________
consensus CAGGCACTAACAAGAGCACTGAGAGCCACCGGCACTTCCAGGTTGATCCCAAGCACGTTG
 
. : . : . : . : . : . :
JMFN046E14- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCC
JMFN005L08+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN005L22- GCCTTCAGGGCAGTGCAAAGGCAAACG-GCGACTTCCAAAT-CCGCCAGCCC
JMFN031H05- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN028O22- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF044M04- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN017F03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN031E24- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN009A08+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN043P17+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN012J09+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF019F16- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF038J06- GCCTTCAGGGCANTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN042J13+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF038J05- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN039J11+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN014J08+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN040A24+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN038A20+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN011H08+ GCATTCCGGTCAGTACAAAGTCTACCG-GCGACTTCCAAAT-CCGCCACTCTTCCAATAA
rJMSF015D05- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN041P01+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN040D03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN008H24+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN016M03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN040F05+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN004A14+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF040J13- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN003E18+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN014O03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN009F17+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN031G06+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN032C04+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN017G13+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN006F05+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN005F13+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN043I06- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF047H20- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN029C02+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN005D13+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN013L05+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN041J08+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFS008F10+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN014F05+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN032O03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN043K18+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN042N21+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN003K11+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN042E12+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN004H07+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN003K20+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF012C07- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN018M13+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN017C23+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF006C10- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF013F02- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN003L06+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN012D06+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN014J21+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN013C15+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCAGTGCAAGAA
JMFN018C14+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFS119B08+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN010P23+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN029N23+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN015O16+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFF044M04+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFF047H20+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN042J03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN039C21+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN011B13+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN017I07+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN039G24+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN046J14+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN043F23+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN029I01+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN016C03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN031H15+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFF019D06+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN002B06+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN046B02+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN025D06+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAATCCCGCCAGCCNTGCAAGAA
JMFF037F06+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAATCCCGCCAGCCCTGCAAGAA
JMFN018D19+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFF019F16+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFF013F02+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN042I22+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN006G12+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN005F10+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN006J05+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN028L05+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN006D12+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN015P23+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN010I21+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN013E20+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN014G01+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN035C07+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN015G13+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN016M04+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN014B21+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN013C02+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN014A03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN019A09+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN032H20+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN038C21+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN044M11+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN011J11+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN042H03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN038N01+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN035O15+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN046K09+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN001C06+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN013H12+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMSF039F06- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF019D06- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMFF037F06- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMSF039F06+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN041D10+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN025H03+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN034I19+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFF040J13+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFF012C07+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN028M19+ GCCTTCAGGTCAGTGCAAAGGCAATCG-GCGAGTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN015J09+ GCCTTCAGGGCAGTGCAAAGGCAAGCGTGCGACTTCCCAAT-CCGCCAGCCCTGCAAGAA
JMFF006C10+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFN011P12- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMFF038J05+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
rJMSF047L01- GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
JMSF047L01+ GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
                      ____________________________________________________________
consensus GCCTTCAGGGCAGTGCAAAGGCAAGCG-GCGACTTCCAAAT-CCGCCAGCCCTGCAAGAA
 
. : . : . : . : . : . :
JMFN005L08+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCA
JMFN031H05- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN028O22- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF044M04- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN017F03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN031E24- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN009A08+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN043P17+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN012J09+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF019F16- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF038J06- NAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN042J13+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF038J05- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN039J11+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN014J08+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN040A24+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN038A20+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN011H08+ GAGATCAGCTTGGGCTGGTTCGCGCGTGCCCATGGTCAATGCTCACCAGCCCTCCCGTCA
rJMSF015D05- GAGTGCAGCATGGGCTGGTTGGGG-GTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN041P01+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN040D03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN008H24+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN016M03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN040F05+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN004A14+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF040J13- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN003E18+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN014O03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN009F17+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN031G06+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN032C04+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN017G13+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN006F05+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN005F13+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN043I06- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF047H20- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN029C02+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN005D13+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN013L05+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN041J08+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFS008F10+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN014F05+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN032O03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN043K18+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN042N21+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN003K11+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN042E12+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN004H07+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN003K20+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF012C07- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN018M13+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN017C23+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF006C10- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF013F02- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN003L06+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN012D06+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN014J21+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN013C15+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN018C14+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFS119B08+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN010P23+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN029N23+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN015O16+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF044M04+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF047H20+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN042J03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN039C21+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN011B13+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN017I07+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN039G24+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN046J14+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN043F23+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN029I01+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN016C03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN031H15+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF019D06+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN002B06+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN046B02+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN025D06+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF037F06+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN018D19+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF019F16+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF013F02+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN042I22+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN006G12+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN005F10+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN006J05+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN028L05+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN006D12+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN015P23+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN010I21+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN013E20+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN014G01+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN035C07+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN015G13+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN016M04+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN014B21+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN013C02+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN014A03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN019A09+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN032H20+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN038C21+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN044M11+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN011J11+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN042H03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN038N01+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN035O15+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN046K09+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN001C06+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN013H12+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAG
rJMSF039F06- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF019D06- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMFF037F06- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMSF039F06+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN041D10+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN025H03+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN034I19+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF040J13+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF012C07+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN028M19+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN015J09+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF006C10+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFN011P12- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMFF038J05+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
rJMSF047L01- GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
JMSF047L01+ GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
                      ____________________________________________________________
consensus GAGTGCAGCATGGGCTGGTTGGGGCGTGCCCAAGCTCAATGCTCACCAGCCCTCCCAGCA
 
. : . : . : . : . : . :
JMFN031H05- GATTAGCGCACA
JMFN028O22- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGT
rJMFF044M04- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN017F03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN031E24- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGA
JMFN009A08+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN043P17+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN012J09+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMFF019F16- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMFF038J06- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN042J13+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMFF038J05- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN039J11+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN014J08+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN040A24+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN038A20+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN011H08+ GATTAGTGCACGCGCCCAGCCTCAGTGTGTTCCAAGGCCAGTATGGGTTCACCTCTCGCG
rJMSF015D05- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN041P01+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN040D03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN008H24+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN016M03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN040F05+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN004A14+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMFF040J13- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN003E18+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN014O03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN009F17+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN031G06+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN032C04+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN017G13+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN006F05+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN005F13+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN043I06- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMFF047H20- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN029C02+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCC
JMFN005D13+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN013L05+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN041J08+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFS008F10+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN014F05+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN032O03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN043K18+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN042N21+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN003K11+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN042E12+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN004H07+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN003K20+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGTAGTATGGGTTCACCGGCGGTG
rJMFF012C07- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN018M13+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN017C23+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMFF006C10- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMFF013F02- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN003L06+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN012D06+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN014J21+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN013C15+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN018C14+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFS119B08+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN010P23+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN029N23+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN015O16+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFF044M04+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFF047H20+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN042J03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN039C21+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN011B13+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN017I07+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN039G24+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN046J14+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN043F23+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN029I01+ GATTAGCGCACACGCCCAGCTTCAGTGTATCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN016C03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN031H15+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFF019D06+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN002B06+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN046B02+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN025D06+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFF037F06+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN018D19+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFF019F16+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFF013F02+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN042I22+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN006G12+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN005F10+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN006J05+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN028L05+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN006D12+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN015P23+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN010I21+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN013E20+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN014G01+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN035C07+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN015G13+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN016M04+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN014B21+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN013C02+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN014A03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN019A09+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN032H20+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN038C21+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN044M11+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN011J11+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN042H03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN038N01+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN035O15+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN046K09+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN001C06+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMSF039F06- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMFF019D06- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMFF037F06- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMSF039F06+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN041D10+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN025H03+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN034I19+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFF040J13+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFF012C07+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN028M19+ GATTAGCGCACACGCCAAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN015J09+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGCCAGTATGGGTTCACCGGCGGTG
JMFN035G23+ GAGGGCAGTATGGGTTCACCGGCGGTG
JMFF006C10+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFN011P12- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMFF038J05+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
rJMSF047L01- GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
JMSF047L01+ GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
                      ____________________________________________________________
consensus GATTAGCGCACACGCCCAGCTTCAGTGTGTCCCGAGGGCAGTATGGGTTCACCGGCGGTG
 
. : . : . : . : . : . :
rJMFF044M04- CCTTCGGCGGCAGCTTGGGCGTGCATGTGC
JMFN017F03+ C
JMFN009A08+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAG
JMFN043P17+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN012J09+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMFF019F16- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMFF038J06- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN042J13+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMFF038J05- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN039J11+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN014J08+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN040A24+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN038A20+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN011H08+ CCTTCGGCGGCAGTTTGGGGGTGCATGTTCCGCACGGCTGTCGTCAGAGTGGCTAGG
rJMSF015D05- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN041P01+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN040D03+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN008H24+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN016M03+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN040F05+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN004A14+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMFF040J13- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN003E18+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN014O03+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN009F17+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN031G06+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN032C04+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN017G13+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN006F05+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN005F13+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN043I06- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTC
rJMFF047H20- CCTTCGGCGGCAGCTTGGGCGTGCATGTGC
JMFN005D13+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN013L05+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN041J08+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFS008F10+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN014F05+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN032O03+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN043K18+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN042N21+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN003K11+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN042E12+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN004H07+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN003K20+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMFF012C07- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGG
JMFN018M13+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN017C23+ CCTTCGGTGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMFF006C10- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMFF013F02- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN003L06+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGGCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN012D06+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN014J21+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN013C15+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN018C14+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFS119B08+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN010P23+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN029N23+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN015O16+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFF044M04+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFF047H20+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN042J03+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN039C21+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN011B13+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN017I07+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN039G24+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN046J14+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN043F23+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN029I01+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN016C03+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN031H15+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFF019D06+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN002B06+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN046B02+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN025D06+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFF037F06+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN018D19+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFF019F16+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFF013F02+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN042I22+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN006G12+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN005F10+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN006J05+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN028L05+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN006D12+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN015P23+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN010I21+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN013E20+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN014G01+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN035C07+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN015G13+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN016M04+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN014B21+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN013C02+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN014A03+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN019A09+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN032H20+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN038C21+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN044M11+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN011J11+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN042H03+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN038N01+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN035O15+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN046K09+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN001C06+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMSF039F06- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMFF019D06- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMFF037F06- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMSF039F06+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN041D10+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN025H03+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN034I19+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFF040J13+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFF012C07+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN028M19+ CCTTCGGCGGCAGCTTGGGCGTGCATGTTCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN015J09+ CTTTCCCCGGCAGCTTGGGCGTGCATCTTCCGCAC-GCTGTCGTGAGAGTGGATAGGAGG
JMFN035G23+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFF006C10+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMFN011P12- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGA
JMFF038J05+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
rJMSF047L01- CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
JMSF047L01+ CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
                      ____________________________________________________________
consensus CCTTCGGCGGCAGCTTGGGCGTGCATGTGCCGCAC-GCTGTCGTGAGAGTGGCTAGGAGG
 
. : . : . : . : . : . :
JMFN043P17+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGC
JMFN012J09+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCC
rJMFF019F16- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGANGATTTTCTCTTC
rJMFF038J06- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN042J13+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
rJMFF038J05- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAGCCTGGGAGGATTTTCTCTTC
JMFN039J11+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-GGGGGAGGATTTTCTCTTC
JMFN014J08+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN040A24+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN038A20+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
rJMSF015D05- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN041P01+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN040D03+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN008H24+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN016M03+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN040F05+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN004A14+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN003E18+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN014O03+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN009F17+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN031G06+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN032C04+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN017G13+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN006F05+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGG
JMFN005F13+ AGAAGGGAGAGGGTGAAAATGGTCTTG
JMFN005D13+ AGAAGGGAGAGGGTGAAAATGGTCTTG
JMFN013L05+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN041J08+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATGTTCTCT
JMFS008F10+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTC
JMFN014F05+ AGAAGGGAGAGGGT-AAAATGGTCTTGGTGGCC
JMFN032O03+ AGAAGGGAGAGGG
JMFN043K18+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGG
JMFN042N21+ AGAAGGGAGAGGGTGAAAA
JMFN003K11+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTC
JMFN042E12+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTT
JMFN004H07+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN003K20+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTC
JMFN018M13+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGG
JMFN017C23+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGG
rJMFF006C10- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
rJMFF013F02- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN003L06+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN012D06+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN014J21+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN013C15+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN018C14+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFS119B08+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN010P23+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN029N23+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGA
JMFN015O16+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFF044M04+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFF047H20+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN042J03+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN039C21+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN011B13+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN017I07+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN039G24+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN046J14+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN043F23+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN029I01+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN016C03+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN031H15+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFF019D06+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN002B06+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN046B02+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN025D06+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFF037F06+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN018D19+ AGAAGGGAGAGGGTGAAAATGGTCTT
JMFF019F16+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFF013F02+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN042I22+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN006G12+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN005F10+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN006J05+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN028L05+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN006D12+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN015P23+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN010I21+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN013E20+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN014G01+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN035C07+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN015G13+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN016M04+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN014B21+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN013C02+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN014A03+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN019A09+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN032H20+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN038C21+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN044M11+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN011J11+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN042H03+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN038N01+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN035O15+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN046K09+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGG
JMFN001C06+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAG
rJMSF039F06- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
rJMFF019D06- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
rJMFF037F06- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMSF039F06+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN041D10+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCA
JMFN025H03+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG
JMFN034I19+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCC
JMFF040J13+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFF012C07+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFN028M19+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGG
JMFN015J09+ AAAAGGGAGAGGGTTTAAA-GGTATTGGTGGCCATGGCAG-C
JMFN035G23+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFF006C10+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMFF038J05+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
rJMSF047L01- AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
JMSF047L01+ AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
                      ____________________________________________________________
consensus AGAAGGGAGAGGGTGAAAATGGTCTTGGTGGCCATGGCAG-CTGGGAGGATTTTCTCTTC
 
. : . : . : . : . : . :
rJMFF019F16- TCTGC
rJMFF038J06- TCT
JMFN042J13+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATG
rJMFF038J05- TCT
JMFN039J11+ TCTGCTCTGCTCTCTCAAGATCTAAG
JMFN014J08+ TCTGCTCTGCTCTCTCAAGATC
JMFN040A24+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN038A20+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
rJMSF015D05- TC
JMFN041P01+ TCTGCTCTGCTCTCTCAAGATCTAA
JMFN040D03+ TCTGCTCTGCTCTC
JMFN008H24+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATG
JMFN016M03+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATG
JMFN040F05+ TCTGCTCTGCTCTCTCAAGATCTAA
JMFN004A14+ TCTGCTCTGCTCTCTCAAGATC
JMFN003E18+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATG
JMFN014O03+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGT
JMFN009F17+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN031G06+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTA
JMFN032C04+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFN017G13+ TCTGCTCTGCTCTCTCAAGATCTAA
JMFN013L05+ TCTGCTCTGCTCTCTCAAGATCTAA
JMFN004H07+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTAT
rJMFF006C10- TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGT
rJMFF013F02- TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTA
JMFN003L06+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFN012D06+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGT
JMFN014J21+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAG
JMFN013C15+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTG
JMFN018C14+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGT
JMFS119B08+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN010P23+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFN015O16+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFF044M04+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGT
JMFF047H20+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGT
JMFN042J03+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTT
JMFN039C21+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTT
JMFN011B13+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTT
JMFN017I07+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTT
JMFN039G24+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFN046J14+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN043F23+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN029I01+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFN016C03+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGT
JMFN031H15+ TCTGCTCTGCTCTCTCAAGATCTAAG
JMFF019D06+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGT
JMFN002B06+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTT
JMFN046B02+ TCTGCTCTGCTCTCTCAAGATCTAA
JMFN025D06+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFF037F06+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGT
JMFF019F16+ TCTGC
JMFF013F02+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGT
JMFN042I22+ TCTGCTCTGCTCTCTCAAGATCTAA
JMFN006G12+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGT
JMFN005F10+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAG
JMFN006J05+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFN028L05+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN006D12+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN015P23+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN010I21+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTAT
JMFN013E20+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTAT
JMFN014G01+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTAT
JMFN035C07+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTT
JMFN015G13+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTA
JMFN016M04+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTA
JMFN014B21+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFN013C02+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFN014A03+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTA
JMFN019A09+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTG
JMFN032H20+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN038C21+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN044M11+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGG
JMFN011J11+ TCTGCTCTGCTCTCTCAAGATCTAA
JMFN042H03+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATA
JMFN038N01+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTA
JMFN035O15+ TCTGCTCTGCTCTCTCAAGATCTAA
rJMSF039F06- TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGT
rJMFF019D06- TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTA
rJMFF037F06- TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTT
JMSF039F06+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGT
JMFF040J13+ TCT
JMFF012C07+ TCT
JMFN035G23+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTA
JMFF006C10+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTA
JMFF038J05+ TCTC
rJMSF047L01- TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGT
JMSF047L01+ TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGTAGGGTC
                      ____________________________________________________________
consensus TCTGCTCTGCTCTCTCAAGATCTAAGGGTATATATGGTAGTGTTTGCTTAGGGTAGGGTC