Previous Contig 007796:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045B01Sequence646007796 (3)pir|G86349|G863492e-08hypothetical protein F8K7.8 - Arabidopsis thaliana>gb:AE005172_891114 Arabidopsi609014021 (4)gb:AY081334_15686801e-48Arabidopsis thaliana auxilin-like protein (At4g12780) mRNA, complete cds.>gb:BT0
JMSF047K04Sequence158007796 (3)732014021 (4)gb:AP002870_18234985e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMSF052K22Sequence121007796 (3)830014021 (4)gb:AP002870_18234981e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045B01+ CCAAACAAATCATCAACCGAATCACTCGGCTTGGGC
                      ____________________________________________________________
consensus CCAAACAAATCATCAACCGAATCACTCGGCTTGGGC
 
. : . : . : . : . : . :
JMFF045B01+ GCAGACCCGAAAAAATCAAACTCGTCTCTCAAATTCGAATTGTTTCTGTTATTCCCGTTC
                      ____________________________________________________________
consensus GCAGACCCGAAAAAATCAAACTCGTCTCTCAAATTCGAATTGTTTCTGTTATTCCCGTTC
 
. : . : . : . : . : . :
JMFF045B01+ TGATTCGTCGAACCCTTAAAAAACGTGTCCAAATCGACATGACTTTGCTGGGCGGTGGTC
                      ____________________________________________________________
consensus TGATTCGTCGAACCCTTAAAAAACGTGTCCAAATCGACATGACTTTGCTGGGCGGTGGTC
 
. : . : . : . : . : . :
JMFF045B01+ GAGTTCGAACTCGGGAACTGCCCGCCAAAGATATCACTATTGTCATAATTCTGTTGCCCA
                      ____________________________________________________________
consensus GAGTTCGAACTCGGGAACTGCCCGCCAAAGATATCACTATTGTCATAATTCTGTTGCCCA
 
. : . : . : . : . : . :
JMFF045B01+ GAAGTTTTACCGGATCGGAAAACGCCATCCAGATCATAGGGATCCGAATTGTGGGAAGAC
                      ____________________________________________________________
consensus GAAGTTTTACCGGATCGGAAAACGCCATCCAGATCATAGGGATCCGAATTGTGGGAAGAC
 
. : . : . : . : . : . :
JMFF045B01+ TTTTGCCCCGAATCGTTAGGGAAACCACTGCTGGGCTTGCTTTTAGCTTTTAAATTGGCC
                      ____________________________________________________________
consensus TTTTGCCCCGAATCGTTAGGGAAACCACTGCTGGGCTTGCTTTTAGCTTTTAAATTGGCC
 
. : . : . : . : . : . :
JMFF045B01+ AAAGGAATCGAATTTCCACGCGACTTGACGCCATACCGCTCAACCAGAACTCCAAACTCA
                      ____________________________________________________________
consensus AAAGGAATCGAATTTCCACGCGACTTGACGCCATACCGCTCAACCAGAACTCCAAACTCA
 
. : . : . : . : . : . :
JMFF045B01+ TCCATGTTCTTGTATTCCTTTATTATATAAGATATATGTATATATACACACAATTGTATA
                      ____________________________________________________________
consensus TCCATGTTCTTGTATTCCTTTATTATATAAGATATATGTATATATACACACAATTGTATA
 
. : . : . : . : . : . :
JMFF045B01+ TGTTTATAATGTATAAGTTTCTAGAAATATGTAAACAGAAACCAATCGTATTCAGAAGTG
                      ____________________________________________________________
consensus TGTTTATAATGTATAAGTTTCTAGAAATATGTAAACAGAAACCAATCGTATTCAGAAGTG
 
. : . : . : . : . : . :
JMFF045B01+ GAAAGGGTTTCAAAAAAGAAAAAAAAAAAAAAAAGGTGGAAAGGAGGAAGGATGAAGAAG
JMSF052K22+ AAAAAAAAAAAAAGGTGGAAAGGAGGAAGGATGAAGAAG
JMSF047K04+ AAAAAAAAAAAAGGTGGAAAGGAGGAAGGATGAAGAAG
                      ____________________________________________________________
consensus GAAAGGGTTTCAAAAAAGAAAAAAAAAAAAAAAAGGTGGAAAGGAGGAAGGATGAAGAAG
 
. : . : . : . : . : . :
JMFF045B01+ AGGAATGAACCGAGGATGAAGGAGTGAGAGAGAAAACGGAGTGAAATGGAGCTTCTTTCT
JMSF052K22+ AGGAATGAACCGAGGATGAAGGAGTGAGAGAGAAAACGGAGTGAAATGGAGCTTCTTTCT
JMSF047K04+ AGGAATGAACCGAGGATGAAGGAGTGAGAGAGAAAACGGAGTGAAATGGAGCTTCTTTCT
                      ____________________________________________________________
consensus AGGAATGAACCGAGGATGAAGGAGTGAGAGAGAAAACGGAGTGAAATGGAGCTTCTTTCT
 
. : . : . : . : . : . :
JMFF045B01+ CTCTCCTC
JMSF052K22+ CTCTCCTC
JMSF047K04+ CTCTCCTCTTAACTCTTTCTCTCTCCCCTCTCCCTATTAAGGCGTTTGAAGCTGTCGTGC
                      ____________________________________________________________
consensus CTCTCCTCTTAACTCTTTCTCTCTCCCCTCTCCCTATTAAGGCGTTTGAAGCTGTCGTGC