Previous Contig 007793:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005N03Sequence504007793 (2)gb:AF036309_17629452e-07Arabidopsis thaliana scarecrow-like 14 (SCL14) mRNA, partial cds.682013723 (2)gb:AC097277_17365093e-65Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete sequence.
JMSF047J10Sequence680007793 (2)gb:AF036309_17629451e-07Arabidopsis thaliana scarecrow-like 14 (SCL14) mRNA, partial cds.715013723 (2)gb:AC097277_17365091e-64Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047J10+ TTCTGCAGAACCATTGTCGG
                      ____________________________________________________________
consensus TTCTGCAGAACCATTGTCGG
 
. : . : . : . : . : . :
JMSF047J10+ AGGAGGAGTAGTAGTAATGGTTTCTTTTCCCCTTGGACGGCGAATTTTCCCCCTCGCTCA
                      ____________________________________________________________
consensus AGGAGGAGTAGTAGTAATGGTTTCTTTTCCCCTTGGACGGCGAATTTTCCCCCTCGCTCA
 
. : . : . : . : . : . :
JMSF047J10+ GATTGAGAATATTACTGTCATTTGGAAGGCCTATTGCTGCTCCTGTGCTTGCATAGTGAC
                      ____________________________________________________________
consensus GATTGAGAATATTACTGTCATTTGGAAGGCCTATTGCTGCTCCTGTGCTTGCATAGTGAC
 
. : . : . : . : . : . :
JMFF005N03+ TGAAACTGAGGGCTTAAATCTGAAT
JMSF047J10+ TGAACAAAGAGTCGGGGAAGCCATTGGAGGAGCTCTGAAACTGAGGGCTTAAATCTGAAT
                      ____________________________________________________________
consensus TGAACAAAGAGTCGGGGAAGCCATTGGAGGAGCTCTGAAACTGAGGGCTTAAATCTGAAT
 
. : . : . : . : . : . :
JMFF005N03+ CGCCATTGTTGAGATCAGATGAACAGGTGCTGGGACTACTCCCCGCGAAACTGGGGGTGA
JMSF047J10+ CGCCATTGTTGAGATCAGATGAACAGGTGCTGGGACTACTCCCCGCGAAACTGGGGGTGA
                      ____________________________________________________________
consensus CGCCATTGTTGAGATCAGATGAACAGGTGCTGGGACTACTCCCCGCGAAACTGGGGGTGA
 
. : . : . : . : . : . :
JMFF005N03+ TGGATACATGCGAGTTTTCGCCCGAGGAGCCGTTAAGCACGTCGGAGAAGTATTTCTCGG
JMSF047J10+ TGGATACATGCGAGTTTTCGCCCGAGGAGCCGTTAAGCACGTCGGAGAAGTATTTCTCGG
                      ____________________________________________________________
consensus TGGATACATGCGAGTTTTCGCCCGAGGAGCCGTTAAGCACGTCGGAGAAGTATTTCTCGG
 
. : . : . : . : . : . :
JMFF005N03+ TGGCGTGGAGAGCCATGCAGTCGCGAAACATGCAAGGCTGATTCTCCAGGTCCTCCTCCT
JMSF047J10+ TGGCGTGGAGAGCCATGCAGTCGCGAAACATGCAAGGCTGATTCTCCAGGTCCTCCTCCT
                      ____________________________________________________________
consensus TGGCGTGGAGAGCCATGCAGTCGCGAAACATGCAAGGCTGATTCTCCAGGTCCTCCTCCT
 
. : . : . : . : . : . :
JMFF005N03+ CCATTAACATCTGGTAAATGTACTTGAGAATCGCATCGGAGTAGTCCCCTTCCGGCCCTT
JMSF047J10+ CCATTAACATCTGGTTAATGTACTTGAGAATCGCATCGGAGTAGTCCCCTTCCGGCCCTT
                      ____________________________________________________________
consensus CCATTAACATCTGGTTAATGTACTTGAGAATCGCATCGGAGTAGTCCCCTTCCGGCCCTT
 
. : . : . : . : . : . :
JMFF005N03+ CCTCCCCTTCGCCTGCAGATCTCTCAACAAGGTTGAATCTCTGCTTCCCCTGATTCACTG
JMSF047J10+ CCTCCCCTTCGCCTGCAGATCTCTCAACAAGGTTGAATCTCTGCTTCCCCTGATTCACTG
                      ____________________________________________________________
consensus CCTCCCCTTCGCCTGCAGATCTCTCAACAAGGTTGAATCTCTGCTTCCCCTGATTCACTG
 
. : . : . : . : . : . :
JMFF005N03+ GTTTTGAGTGGTGGTTGTAGACGAAATCATTTTGCGTGGTAAACAATTCTTGAACCAGAG
JMSF047J10+ GTTTTGAGTGGTGGTTGTAGACGAAATCATTTTGCGTGGTAAACAATTCTTGAACCAGAG
                      ____________________________________________________________
consensus GTTTTGAGTGGTGGTTGTAGACGAAATCATTTTGCGTGGTAAACAATTCTTGAACCAGAG
 
. : . : . : . : . : . :
JMFF005N03+ CCTCCATCACAAGAAACCCCAAAGGAAAAAAAATCAAGAAATAAATGGAAGAGTGGAAGA
JMSF047J10+ CCTCCATCACAAGAAACCCCAAAGGAAAAAAAATCAAGAAATAAATGGAAGAGTGGAAGA
                      ____________________________________________________________
consensus CCTCCATCACAAGAAACCCCAAAGGAAAAAAAATCAAGAAATAAATGGAAGAGTGGAAGA
 
. : . : . : . : . : . :
JMFF005N03+ ACAGAGGGTCTGAAACAGTGGCGAAATGAGAGTGATTTGAAGAGAGGGTTATGGTTTCT
JMSF047J10+ ACAGAGGGTCTGAAACAGTGGCGAAATGAGAGTGATTTGAAGAGAGGGTTATGGTTTCTC
                      ____________________________________________________________
consensus ACAGAGGGTCTGAAACAGTGGCGAAATGAGAGTGATTTGAAGAGAGGGTTATGGTTTCTC