Previous Contig 007786:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS017C02Sequence606007786 (7)gb:AC011765_15374193e-59Arabidopsis thaliana chromosome 1 BAC F1M20 genomic sequence, complete sequence.
JMFS018D05Sequence469007786 (7)gb:AC011765_15374191e-59Arabidopsis thaliana chromosome 1 BAC F1M20 genomic sequence, complete sequence.
JMFS029F02Sequence640007786 (7)gb:AC011765_15374194e-59Arabidopsis thaliana chromosome 1 BAC F1M20 genomic sequence, complete sequence.
JMFS052F03Sequence586007786 (7)gb:AC011765_15374193e-59Arabidopsis thaliana chromosome 1 BAC F1M20 genomic sequence, complete sequence.
JMFS104D03Sequence631007786 (7)gb:AC011765_15374194e-59Arabidopsis thaliana chromosome 1 BAC F1M20 genomic sequence, complete sequence.
JMFS143F06Sequence615007786 (7)gb:AC011765_15374194e-59Arabidopsis thaliana chromosome 1 BAC F1M20 genomic sequence, complete sequence.
JMSF047I04Sequence360007786 (7)gb:AC011765_15374191e-13Arabidopsis thaliana chromosome 1 BAC F1M20 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS104D03+ GCTCGTCTAGC
                      ____________________________________________________________
consensus GCTCGTCTAGC
 
. : . : . : . : . : . :
JMFS104D03+ ATTACAACCGTCGGTGACTTCCTCATCATCTCCTCCGGCGGCGGCGGCTGCGGAGGTGGC
JMFS017C02+ TCCTCATCATCTCATCCGGCGGCGGCGGCTGCGAAGGTGNC
JMFS029F02+ CGTCGGTGACTTCCTCATCATCTCCTCCGGCGGCGGCGGCTGCGAAGGTGNC
JMFS143F06+ CGGCGNCGGCGGCTGCGAAGGTGGC
                      ____________________________________________________________
consensus ATTACAACCGTCGGTGACTTCCTCATCATCTCCTCCGGCGGCGGCGGCTGCGAAGGTGGC
 
. : . : . : . : . : . :
JMFS104D03+ GGCTGCTCTTCTTGCGGTGGCTCCTCCTCCTGAACCAGCTCATCATAGTAATAAATCTTC
JMFS018D05+ CTGCTCTTCTTGCGGTGGCTCCTCCTCCTGAACCAGCTCATCATAGTAATAAATCTTC
JMFS017C02+ GGCTGCTCTTCTTGCGGTGGCTCCTCCTCCTGAACCAGCTCATCATAGTAATAAATCTTC
JMFS029F02+ GCCTGCTCTTCTTGCGGTGGCTCCTCCTCCTGAACCAGCTCATCATAGTAATAAATCTTC
JMFS143F06+ GGCTGCTCTTCTTGCGGTGGCTCCTCCTCCTGAACCAGCTCATCATAGTAATAAATCTTC
JMFS052F03+ CTTGCGGTGGCTCCTCCTCCTGAACCAGCTCATCATAGTAATAAATCTTC
                      ____________________________________________________________
consensus GGCTGCTCTTCTTGCGGTGGCTCCTCCTCCTGAACCAGCTCATCATAGTAATAAATCTTC
 
. : . : . : . : . : . :
JMFS104D03+ AATCCAAGCTCGCCCCGGACCCAGCTGAACACACTCTTCTTCTCCAGCTGAAAATAAATC
JMFS018D05+ AATCCAAGCTCGCCCCGGACCCAGCTGAACACACTCTTCTTCTCCAGCTGAAAATAAATC
JMFS017C02+ AATCCAAGCTCGCCCCGGACCCAGCTGAACACACTCTTCTTCTCCAGCTGAAAATAAATC
JMFS029F02+ AATCCAAGCTCGCCCCGGACCCAGCTGAACACACTCTTCTTCTCCAGCTGAAAATAAATC
JMFS143F06+ AATCCAAGCTCGCCCCGGACCCAGCTGAACACACTCTTCTTCTCCAGCTGAAAATAAATC
JMFS052F03+ AATCCAAGCTCGCCCCGGACCCAGCTGAACACACTCTTCTTCTCCAGCTGAAAATAAATC
                      ____________________________________________________________
consensus AATCCAAGCTCGCCCCGGACCCAGCTGAACACACTCTTCTTCTCCAGCTGAAAATAAATC
 
. : . : . : . : . : . :
JMFS104D03+ AATCCTTCCTCTCCCCGCCTCGCGAACTGCGTTCCGTACACTTTAACCCTCCCGAGAAAA
JMFS018D05+ AATCCTTCCTCTCCCCGCCTCGCGAANTGCGTTCCGTACACTTTAACCCTCCCGAGAAAA
JMFS017C02+ AATCCTTCCTCTCCCCGCCTCGCGAACTGCGTTCCGTACACTTTAACCCTCCCGAGAAAA
JMFS029F02+ AATCCTTCCTCTCCCCGCCTCGCGAACTGCGTTCCGTACACTTTAACCCTCCCGAGAAAA
JMFS143F06+ AATCCTTCCTCTCCCCGCCTCGCGAACTGCGTTCCGTACACTTTAACCCTCCCGAGAAAA
JMFS052F03+ AATCCTTCCTCTCCCCGCCTCGCGAANTGCGTTCCGTACACTTTAACCCTCCCGAGAAAA
                      ____________________________________________________________
consensus AATCCTTCCTCTCCCCGCCTCGCGAACTGCGTTCCGTACACTTTAACCCTCCCGAGAAAA
 
. : . : . : . : . : . :
JMFS104D03+ TGATTCTTCCTCGCGTTCCCATTGCTCAGCTTCTTGTCGTTGTACACATCAATCTCCAGC
JMFS018D05+ TGATTCTTCCTCGCGTTCCCATTGCTCAGCTTCTTGTCGTTGTACACATCAATCTCCAGC
JMFS017C02+ TGATTCTTCCTCGCGTTCCCATTGCTCAGCTTCTTGTCGTTGTACACATCAATCTCCAGC
JMFS029F02+ TGATTCTTCCTCGCGTTCCCATTGCTCAGCTTCTTGTCGTTGTACACATCAATCTCCAGC
JMFS143F06+ TGATTCTTCCTCGCGTTCCCATTGCTCAGCTTCTTGTCGTTGTACACATCAATCTCCAGC
JMFS052F03+ TGATTCTTCCTCGCGTTCCCATTGCTCAGCTTCTTGTCGTTGTACACATCAATCTCCAGC
                      ____________________________________________________________
consensus TGATTCTTCCTCGCGTTCCCATTGCTCAGCTTCTTGTCGTTGTACACATCAATCTCCAGC
 
. : . : . : . : . : . :
JMFS104D03+ TCCTCAAACTCCATCGTCTTCGGATCCGACACAACGAACTCCAGCACCTCGTTCCATACC
JMFS018D05+ TCCTCAAACTCCATCGTCTTCGGATCCGACACAACGAACTCCAGCACCTCGTTCCATACC
JMFS017C02+ TCCTCAAACTCCATCGTCTTCGGATCCGACACAACGAACTCCAGCACCTCGTTCCATACC
JMFS029F02+ TCCTCAAACTCCATCGTCTTCGGATCCGACACAACGAACTCCAGCACCTCGTTCCATACC
JMFS143F06+ TCCTCAAACTCCATCGTCTTCGGATCCGACACAACGAACTCCAGCACCTCGTTCCATACC
JMFS052F03+ TCCTCAAACTCCATCGTCTTCGGATCCGACACAACGAACTCCAGCACCTCGTTCCATACC
                      ____________________________________________________________
consensus TCCTCAAACTCCATCGTCTTCGGATCCGACACAACGAACTCCAGCACCTCGTTCCATACC
 
. : . : . : . : . : . :
JMFS104D03+ GGATTCAAGTTTCTGCAAACGGTTGACGTCCGCCGTTTCTGGCCGTCAAAGTCCACCACC
JMFS018D05+ GGATTCAAGTTTCTGCAAACGGTTGACGTCCGCCGTTTCTGGCCGTCAAAGTCCACCACC
JMFS017C02+ GGATTCAAGTTTCTGCAAACGGTTGACGTCCGCCGTTTCTGGCCGTCAAAGTCCACCACC
JMFS029F02+ GGATTCAAGTTTCTGCAAACGGTTGACGTCCGCCGTTTCTGGCCGTCAAAGTCCACCACC
JMFS143F06+ GGATTCAAGTTTCTGCAAACGGTTGACGTCCGCCGTTTCTGGCCGTCAAAGTCCACCACC
JMFS052F03+ GGATTCAAGTTTCTGCAAACGGTTGACGTCCGCCGTTTCTGGCCGTCAAAGTCCACCACC
JMSF047I04+ GGATTCAAGTTTCTGCAAACGGTTGACGTCCGCCGTTTCTGGCCGTCAAAGTCCACCACC
                      ____________________________________________________________
consensus GGATTCAAGTTTCTGCAAACGGTTGACGTCCGCCGTTTCTGGCCGTCAAAGTCCACCACC
 
. : . : . : . : . : . :
JMFS104D03+ ACATACGCGCTAGAACTTCCCTGGCCGTCCTTGGGAAGGAGATTCCGGGCGTCGATCACC
JMFS018D05+ ACATACGCGCTAGAACTTCCCTGGCCGTCCTTGGGAAGGAGATTCCGGGCGTCGATCACC
JMFS017C02+ ACATACGCGCTAGAACTTCCCTGGCCGTCCTTGGGAAGGAGATTCCGGGCGTCGATCACC
JMFS029F02+ ACATACGCGCTAGAACTTCCCTGGCCGTCCTTGGGAAGGAGATTCCGGGCGTCGATCACC
JMFS143F06+ ACATACGCGCTAGAACTTCCCTGGCCGTCCTTGGGAAGGAGATTCCGGGCGTCGATCACC
JMFS052F03+ ACATACGCGCTAGAACTTCCCTGGCCGTCCTTGGGAAGGAGATTCCGGGCGTCGATCACC
JMSF047I04+ ACATACGCGCTAGAACTTCCCTGCCCGTCCTTGGGAAGGAGATTCCGGGCGTCGATCACC
                      ____________________________________________________________
consensus ACATACGCGCTAGAACTTCCCTGGCCGTCCTTGGGAAGGAGATTCCGGGCGTCGATCACC
 
. : . : . : . : . : . :
JMFS104D03+ TCTATCACAAGCTTTCGGATCGCTTGTGGCGCTTTCTGCGGCGGCGGCGGCGGTGGCTGC
JMFS018D05+ TCTATCACAAGCTTTCGGATCGCTTGTGGCGCTTTCTGCGGCGGCGGCGGC
JMFS017C02+ TCTATCACAAGCTTTCGGATCGCTTGTGGCGCTTTCTGCGGCGGCGGCGGCGGTGGCTGC
JMFS029F02+ TCTATCACAAGCTTTCGGATCGCTTGTGGCGCTTTCTGCGGCGGCGGCGGCGGTGGCTGC
JMFS143F06+ TCTATCACAAGCTTTCGGATCGCTTGTGGCGCTTTCTGCGGCGGCGGCGGCGGTGGCTGC
JMFS052F03+ TCTATCACAAGCTTTCGGATCGCTTGTGGCGCTTTCTGCGGCGGCGGCGGCGGTGGCTGC
JMSF047I04+ TCTATCACAAGCTTTCGGATCGCTTGTGGCGCTTTNTGCGGCGGCGGCGGCGGTGGCTGC
                      ____________________________________________________________
consensus TCTATCACAAGCTTTCGGATCGCTTGTGGCGCTTTCTGCGGCGGCGGCGGCGGTGGCTGC
 
. : . : . : . : . : . :
JMFS104D03+ TGTTGTTGCTGCTGCGGCGGCGGTGGATGATCCGGATGCTCTGATGACGCCGTCATGGTT
JMFS017C02+ TGTTGTTGCTGCTGCGGCGGCGGTGGATGATCCGGATGCTCTGATGACGCCGTCATGGTT
JMFS029F02+ TGTTGTTGCTGCTGCGGCGGCGGTGGATGATCCGGATGCTCTGATGACGCCGTCATGGTT
JMFS143F06+ TGTTGTTGCTGCTGCGGCGGCGGTGGATGATCCGGATGCTCTGATGACGCCGTCATGGTT
JMFS052F03+ TGTTGTTGCTGCTGCGGCGGCGGTGGATGATCCGGATGCTCTGATGACGCCGTCATGGTT
JMSF047I04+ TGTTGTTGNTGCTGNGGCGGCGGTGGATGATCCGGATGCTCTGATGACGCCGTCATGGTT
                      ____________________________________________________________
consensus TGTTGTTGCTGCTGCGGCGGCGGTGGATGATCCGGATGCTCTGATGACGCCGTCATGGTT
 
. : . : . : . : . : . :
JMFS104D03+ TCATTATGCGGGCGTGGCCG
JMFS017C02+ TCATTATGCGGGCGTGGCCGTTGAA
JMFS029F02+ TCATTATGCGGGCGTGGCCGTTGAAGGCGGTAAAGGACTGTTGTGAGT
JMFS143F06+ TCATTATGCGGGCGTGGCCGTTGAAGGCGGTAAAGGACTGTTGTGAGT
JMFS052F03+ TCATTATGCGGGCGTGGCCGTTGAAGGCGGTAAAGGACTGTTGTGAGTGA
JMSF047I04+ TCATTATGCGGGCGTGGCCGTTGAAGGCGGTAAAGGACTGTTGNGAGTGAGAGAGAGAGA
                      ____________________________________________________________
consensus TCATTATGCGGGCGTGGCCGTTGAAGGCGGTAAAGGACTGTTGTGAGTGAGAGAGAGAGA
 
. : . : . : . : . : . :
JMSF047I04+ GAAAAGGGGAGAAGAAGTTTTTTGTTATGAATTCTTTTATTNTGATGCTTTGCTTCTTTC
                      ____________________________________________________________
consensus GAAAAGGGGAGAAGAAGTTTTTTGTTATGAATTCTTTTATTNTGATGCTTTGCTTCTTTC