Previous Contig 007785:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018K16Sequence544007785 (2)gb:AY074262_15674241e-16Arabidopsis thaliana unknown protein (At3g55150) mRNA, complete cds.>gb:AY096453686021077gb:AY775043_11800182e-33Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 197 (ACRE197) mRNA, partial
JMSF047I03Sequence597007785 (2)gb:AY074262_15674242e-18Arabidopsis thaliana unknown protein (At3g55150) mRNA, complete cds.>gb:AY096453151007670 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018K16+ TCCAGAAAGTAGCGATTTCCAGATAAAATAGTATAGA
JMSF047I03+ CGGAACACCTGGTTGAGGGATCCAGAAAGTAGCGATTTCCAGATAAAATAGTATAGA
                      ____________________________________________________________
consensus CGGAACACCTGGTTGAGGGATCCAGAAAGTAGCGATTTCCAGATAAAATAGTATAGA
 
. : . : . : . : . : . :
JMFF018K16+ ACTCTTTCTGAAGCCTTTTCATGGCGATTTGCATCAAGTTATGAGCTATAACGAGCTGCT
JMSF047I03+ ACTCTTTCTGAAGCCTTTTCATGGCGATTTGCATCAAGTTATGAGCTATAACGAGCTGCT
                      ____________________________________________________________
consensus ACTCTTTCTGAAGCCTTTTCATGGCGATTTGCATCAAGTTATGAGCTATAACGAGCTGCT
 
. : . : . : . : . : . :
JMFF018K16+ CAGAGCTCGAATTCTCCATGGCCACTAGTTGCATAGCATGCTGCAAGTCGTTGACGCAAC
JMSF047I03+ CAGAGCTCGAATTCTCCATGGCCACTAGTTGCATAGCATGCTGCAAGTCGTTGACGCAAC
                      ____________________________________________________________
consensus CAGAGCTCGAATTCTCCATGGCCACTAGTTGCATAGCATGCTGCAAGTCGTTGACGCAAC
 
. : . : . : . : . : . :
JMFF018K16+ ACAGAAACTCCATAGCCTCTACCCGATTATCCCGGAAAAGGTAGGAGATTCTCTCGTACG
JMSF047I03+ ACAGAAACTCCATAGCCTCTACCCGATTATCCCGGAAAAGGTAGGAGATTCTCTCGTACG
                      ____________________________________________________________
consensus ACAGAAACTCCATAGCCTCTACCCGATTATCCCGGAAAAGGTAGGAGATTCTCTCGTACG
 
. : . : . : . : . : . :
JMFF018K16+ TTGCCGTCCCTTCAAGGTCCCATTTCCGGATCATCGGTTNTACGGTCGCAATCGTTTCTT
JMSF047I03+ TTGCCGTCCCTTCAAGGTCCCATTTCCGGATCATCGGTTCTACGGTCGCAATCGTTTCTT
                      ____________________________________________________________
consensus TTGCCGTCCCTTCAAGGTCCCATTTCCGGATCATCGGTTCTACGGTCGCAATCGTTTCTT
 
. : . : . : . : . : . :
JMFF018K16+ TCATGAGCGTTTCGGAAAACGAACAGCGAGGAGGAGACGGCGACGGCGACGGCGACGGCG
JMSF047I03+ TCATGAGCGTTTCGGAAAACGAACAGCGAGGAGGAGACGGCGACGGCGACGGCGACGGCG
                      ____________________________________________________________
consensus TCATGAGCGTTTCGGAAAACGAACAGCGAGGAGGAGACGGCGACGGCGACGGCGACGGCG
 
. : . : . : . : . : . :
JMFF018K16+ ACGGTGATTTTGACCGGAAACTCAGAGGGGATCCAGGCTTCGATGATGAGAAAAACCCAC
JMSF047I03+ ACGGTGATTTTGACCGGAAACTCAGAGGGGATCCAGGCTTCGATGATGAGAAAAACCCAC
                      ____________________________________________________________
consensus ACGGTGATTTTGACCGGAAACTCAGAGGGGATCCAGGCTTCGATGATGAGAAAAACCCAC
 
. : . : . : . : . : . :
JMFF018K16+ CTCCCATTTTCGATCTGATCTGTTCTTTACCTACAATTAAATTAAATCCTCGATCTCAAA
JMSF047I03+ CTCCCATTTTCGATCTGATCTGTTCTTTACCTACAATTAAATTAAATCCTCGATCTCAAA
                      ____________________________________________________________
consensus CTCCCATTTTCGATCTGATCTGTTCTTTACCTACAATTAAATTAAATCCTCGATCTCAAA
 
. : . : . : . : . : . :
JMFF018K16+ ATCAAATCTTTTTTCAGAGGAGGGTATTGAATTGAAGAAAGAAATGAGCTTTTTTCGTTT
JMSF047I03+ ATCAAATCTTTTTTCAGAGGAGGGTATTGAATTGAAGAAAGAAATGAGCTTTTTTCGTTT
                      ____________________________________________________________
consensus ATCAAATCTTTTTTCAGAGGAGGGTATTGAATTGAAGAAAGAAATGAGCTTTTTTCGTTT
 
. : . : . : . : . : . :
JMFF018K16+ TCAGATGTAGTTAGACAAGGTGGGTAC
JMSF047I03+ TCAGATGTAGTTAGACAAGGTGGGTACGAGAAGGGAGACTGAGAATGCATGGGGTATCTC
                      ____________________________________________________________
consensus TCAGATGTAGTTAGACAAGGTGGGTACGAGAAGGGAGACTGAGAATGCATGGGGTATCTC