Previous Contig 007783:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN041E12Sequence216007783 (5)
JMSF028D09Sequence659007783 (5)gb:AC087851_17341882e-56Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.719007783 (5)gb:AC087851_17341884e-56Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.
JMSF047G15Sequence710007783 (5)gb:AC087851_17341884e-57Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.732007783 (5)gb:AC087851_17341885e-57Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028D09- AGGAGAGAAAACTGTCTCAATGCTTTCACAATAA
                      ____________________________________________________________
consensus AGGAGAGAAAACTGTCTCAATGCTTTCACAATAA
 
. : . : . : . : . : . :
rJMSF028D09- GATGCACTTGACATGGAAATGGGAAGAAAAACTAAAGCCAAAATGTTAAATGCTTACAAA
rJMSF047G15- AA
                      ____________________________________________________________
consensus GATGCACTTGACATGGAAATGGGAAGAAAAACTAAAGCCAAAATGTTAAATGCTTACAAA
 
. : . : . : . : . : . :
rJMSF028D09- AATCACCAACACATCAGCATAACATGTGGTGAGAAAATGGAAAGTTAACATACAAATTAA
JMSF028D09+ A
rJMSF047G15- AATCACCAACACATCAGCATAACATGTGGTGAGAAAATGGAAAGTTAACATACAAATTAA
JMSF047G15+ ACATCAGCATAACATGTGGTGAGAAAATGGAAAGTTAACATACAAATTAA
                      ____________________________________________________________
consensus AATCACCAACACATCAGCATAACATGTGGTGAGAAAATGGAAAGTTAACATACAAATTAA
 
. : . : . : . : . : . :
rJMSF028D09- GGAAAGAAAATTATACATATTTTGTTGGATTCCATATCATCTCCTCAAATCAACTAAGTG
JMSF028D09+ GGAAAGAAAATTATACATATTTTGTTGGATTCCATATCATCTCCTCAAATCAACTAAGTG
rJMSF047G15- GGAAAGAAAATTATACATATTTTGTTGGATTCCATATCATCTCCTCAAATCAACTAAGTG
JMSF047G15+ GGAAAGAAAATTATACATATTTTGTTGGATTCCATATCATCTCCTCAAATCAACTAAGTG
                      ____________________________________________________________
consensus GGAAAGAAAATTATACATATTTTGTTGGATTCCATATCATCTCCTCAAATCAACTAAGTG
 
. : . : . : . : . : . :
rJMSF028D09- CTGCTTATTCATCCGCCATTGCTAATTCCAGTGCATAATCATCCCTTTCAATAGGTCCTC
JMSF028D09+ CTGCTTATTCATCCGCCATTGCTAATTCCAGTGCATAATCATCCCTTTCAATAGGTCCTC
rJMSF047G15- CTGCTTATTCATCCGCCATTGCTAATTCCAGTGCATAATCATCCCTTTCAATAGGTCCTC
JMSF047G15+ CTGCTTATTCATCCGCCATTGCTAATTCCAGTGCATAATCATCCCTTTCAATAGGTCCTC
                      ____________________________________________________________
consensus CTGCTTATTCATCCGCCATTGCTAATTCCAGTGCATAATCATCCCTTTCAATAGGTCCTC
 
. : . : . : . : . : . :
rJMSF028D09- GGGCAAAATATCTTCCAAATTGGAGCCAATATACCTCATCCTCATCCTGCGTTTCAACTT
JMSF028D09+ GGGCAAAATATCTTCCAAATTGGAGCCAATATACCTCATCCTCATCCTGCGTTTCAACTT
rJMSF047G15- GGGCAAAATATCTTCCAAATTGGAGCCAATATACCTCATCCTCATCCTGCGTTTCAACTT
JMSF047G15+ GGGCAAAATATCTTCCAAATTGGAGCCAATATACCTCATCCTCATCCTGCGTTTCAACTT
                      ____________________________________________________________
consensus GGGCAAAATATCTTCCAAATTGGAGCCAATATACCTCATCCTCATCCTGCGTTTCAACTT
 
. : . : . : . : . : . :
rJMSF028D09- CAAGGTCAGTTGATGGAAAACCCACACACAGAAGAGCATATCCCTTCATTTTCAATTCAT
JMSF028D09+ CAAGGTCAGTTGATGGAAAACCCACACACAGAAGAGCATATCCCTTCATTTTCAATTCAT
rJMSF047G15- CAAGGTCAGTTGATGGAAAACCCACACACAGAAGAGCATATCCCTTCATTTTCAATTCAT
JMSF047G15+ CAAGGTCAGTTGATGGAAAACCCACACACAGAAGAGCATATCCCTTCATTTTCAATTCAT
                      ____________________________________________________________
consensus CAAGGTCAGTTGATGGAAAACCCACACACAGAAGAGCATATCCCTTCATTTTCAATTCAT
 
. : . : . : . : . : . :
rJMSF028D09- TTGAAATCCCTAATGCTTCAGGCTGTCTTATTTGCCCAGATTTTACACGGACGGCACAGC
JMSF028D09+ TTGAAATCCCTAATGCTTCAGGCTGTCTTATTTGCCCAGATTTTACACGGACGGCACAGC
rJMSF047G15- TTGAAATCCCTAATGCTTCAGGCTGTCTTATTTGCCCAGATTTTACACGGACGGCACAGC
JMSF047G15+ TTGAAATCCCTAATGCTTCAGGCTGTCTTATTTGCCCAGATTTTACACGGACGGCACAGC
                      ____________________________________________________________
consensus TTGAAATCCCTAATGCTTCAGGCTGTCTTATTTGCCCAGATTTTACACGGACGGCACAGC
 
. : . : . : . : . : . :
rJMSF028D09- TAGTACAACATCCGTGCCTGCAAGCAAAGGGAAGCCGTATATTCTGATCCTCAGCTGTAT
JMSF028D09+ TAGTACAACATCCGTGCCTGCAAGCAAAGGGAAGCCGTATATTCTGATCCTCAGCTGTAT
rJMSF047G15- TAGTACAACATCCGTGCCTGCAAGCAAAGGGAAGCCGTATATTCTGATCCTCAGCTGTAT
JMSF047G15+ TAGTACAACATCCGTGCCTGCAAGCAAAGGGAAGCCGTATATTCTGATCCTCAGCTGTAT
                      ____________________________________________________________
consensus TAGTACAACATCCGTGCCTGCAAGCAAAGGGAAGCCGTATATTCTGATCCTCAGCTGTAT
 
. : . : . : . : . : . :
rJMSF028D09- GCAAAATGTATTGATCCTCCGGGACGAAGAATTCGTGGACGACGCCGGTTTGACGGTCGT
JMSF028D09+ GCAAAATGTATTGATCCTCCGGGACGAAGAATTCGTGGACGACGCCGGTTTGACGGTCGT
rJMSF047G15- GCAAAATGTATTGATCCTCCGGGACGAAGAATTCGTGGACGACGCCGGTTTGACGGTCGT
JMSF047G15+ GCAAAATGTATTGATCCTCCGGGACGAAGAATTCGTGGACGACGCCGGTTTGACGGTCGT
                      ____________________________________________________________
consensus GCAAAATGTATTGATCCTCCGGGACGAAGAATTCGTGGACGACGCCGGTTTGACGGTCGT
 
. : . : . : . : . : . :
rJMSF028D09- GAACAGTGACTTTGTGAATGGGGACGCTAGAAGGAGGGGAATAGGTGCTACCGTTTTGAG
JMSF028D09+ GAACAGTGACTTTGTGAATGGGGACGCTAGAAGGAGGGGAATAGGTGCTACCGTTTTGAG
JMFN041E12+ AGTGACTTTGTGAGTGGGGACGCTAGAAGGAGGGGAATAGGTGCTACCGTTTTGAG
rJMSF047G15- GAACAGTGACTTTGTGAGTGGGGACGCTAGAAGGAGGGGAATAGGTGCTACCGTTTTGAG
JMSF047G15+ GAACAGTGACTTTGTGAGTGGGGACGCTAGAAGGAGGGGAATAGGTGCTACCGTTTTGAG
                      ____________________________________________________________
consensus GAACAGTGACTTTGTGAGTGGGGACGCTAGAAGGAGGGGAATAGGTGCTACCGTTTTGAG
 
. : . : . : . : . : . :
rJMSF028D09- CGGCGACGGCAGCGGGGGTTCGAAGCTGGGAAGTGGTTTTGCGGGTGCATTTGGCGGAGG
JMSF028D09+ CGGCGACGGCAGCGGGGGTTCGAAGCTGGGAAGTGGTTTTGCGGGTGCATTTGGCGGAGG
JMFN041E12+ CGGCGACGGCAGCGGGGGTTCGAAGCTGGGAAGTGGTTTTGCGGGTGCATTTGGCGGAGG
rJMSF047G15- CGGCGACGGCAGCGGGGGTTCGAAGCTGGGAAGTGGTTTTGCGGGTGCATTTGGCGGAGG
JMSF047G15+ CGGCGACGGCAGCGGGGGTTCGAAGCTGGGAAGTGGTTTTGCGGGTGCATTTGGCGGAGG
                      ____________________________________________________________
consensus CGGCGACGGCAGCGGGGGTTCGAAGCTGGGAAGTGGTTTTGCGGGTGCATTTGGCGGAGG
 
. : . : . : . : . : . :
rJMSF028D09- AGCTTGAAGGGAACTTAACTGAGGA
JMSF028D09+ AGCTTGAAGGGAACTTAACTGAGGACGGCGGCGCGTGAAGCTGGGGTGGGCGGTGGAGCG
JMFN041E12+ AGCTTGAAGGGAACTTAACTGAGGACGGCGGCGCGTGAAGCTGGGGTGGGCGGTGGAGCG
rJMSF047G15- AGCTTGAAGGGAACTTAACTGAGGACGGCGGCGCGTGAAGCTGGGGTGGGCGGTGGAGCG
JMSF047G15+ AGCTTGAAGGGAACTTAACTGAGGACGGCGGCGCGTGAAGCTGGGGTGGGCGGTGGAGCG
                      ____________________________________________________________
consensus AGCTTGAAGGGAACTTAACTGAGGACGGCGGCGCGTGAAGCTGGGGTGGGCGGTGGAGCG
 
. : . : . : . : . : . :
JMSF028D09+ AGTAGCAAGCGTTGCAGCAGGGAGCTTGAAGATCCATTCGTCGGTATAGTTTTAGCT
JMFN041E12+ AGTAGTAAGCGTTGCAGCAGGGAGCTTGAAGATCCATTCG
rJMSF047G15- AGTAGCAAGCGTTGCAGCAGGGAGCTTGAAGATCCATTCGTCGGTATAGTTTTAGCT
JMSF047G15+ AGTAGCAAGCGTTGCAGCAGGGAGCTTGAAGATCCATTCGTCGGTATAGTTTTAGCTACC
                      ____________________________________________________________
consensus AGTAGCAAGCGTTGCAGCAGGGAGCTTGAAGATCCATTCGTCGGTATAGTTTTAGCTACC