Previous Contig 007768:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026F20Sequence653007768 (2)pir|D86283|D862832e-57T15D22.4 protein - Arabidopsis thaliana>gb:AE005172_890496 Arabidopsis thaliana 706013698 (2)pir|D86283|D862831e-56T15D22.4 protein - Arabidopsis thaliana>gb:AE005172_890496 Arabidopsis thaliana
JMSF047C20Sequence683007768 (2)pir|D86283|D862832e-57T15D22.4 protein - Arabidopsis thaliana>gb:AE005172_890496 Arabidopsis thaliana 784013698 (2)pir|D86283|D862833e-65T15D22.4 protein - Arabidopsis thaliana>gb:AE005172_890496 Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026F20+ GACTCCGCCAAATAAGCGTTCTTCTTCA
JMSF047C20+ CGCCAAATAAGCGTTCTTCTTCA
                      ____________________________________________________________
consensus GACTCCGCCAAATAAGCGTTCTTCTTCA
 
. : . : . : . : . : . :
JMSF026F20+ GGGTATAATACCCAATCGCCGGCACATATTTTCCGGCATAACTCTCGCCGGTAATGTAAA
JMSF047C20+ GGGTATAATACCCAATCGCCGGCACATATTTTCCGGCATAACTCTCGCCGGTAATGTAAA
                      ____________________________________________________________
consensus GGGTATAATACCCAATCGCCGGCACATATTTTCCGGCATAACTCTCGCCGGTAATGTAAA
 
. : . : . : . : . : . :
JMSF026F20+ TTGGGCGCGCCTTGAACGAAGCATCCGACGCTATGAACTTCCTAATCGCGATGAAAAGAT
JMSF047C20+ TTGGGCGCGCCTTGAACGAAGCATCCGACGCTATGAACTTCCTAATCGCGATGAAAAGAT
                      ____________________________________________________________
consensus TTGGGCGCGCCTTGAACGAAGCATCCGACGCTATGAACTTCCTAATCGCGATGAAAAGAT
 
. : . : . : . : . : . :
JMSF026F20+ GCTTCGCAACACCCAGTTGGTCCCTCGGGATTTCTTCCGGAGTCGAGGCGACACTAAACC
JMSF047C20+ GCTTCGCAACACCCAGTTGGTCCCTCGGGATTTCTTCCGGAGTCGAGGCGACACTAAACC
                      ____________________________________________________________
consensus GCTTCGCAACACCCAGTTGGTCCCTCGGGATTTCTTCCGGAGTCGAGGCGACACTAAACC
 
. : . : . : . : . : . :
JMSF026F20+ CAGCTCCAATGGGGTTATCCAGAAAAAGAAGCCCAAATATGCGATTCCAAGACCCAGGGT
JMSF047C20+ CAGCTCCAATGGGGTTATCCAGAAAAAGAAGCCCAAATATGCGATTCCAAGACCCAGGGT
                      ____________________________________________________________
consensus CAGCTCCAATGGGGTTATCCAGAAAAAGAAGCCCAAATATGCGATTCCAAGACCCAGGGT
 
. : . : . : . : . : . :
JMSF026F20+ TGGGATCTAAGGAAATCTGTTCTTCTGCGTTTTTCCCCTTAGAAGAAGAAGACACTCGCC
JMSF047C20+ TGGGATCTAAGGAAATCTGTTCTTCTGCGTTTTTCCCCTTAGAAGAAGAAGACACTCGCC
                      ____________________________________________________________
consensus TGGGATCTAAGGAAATCTGTTCTTCTGCGTTTTTCCCCTTAGAAGAAGAAGACACTCGCC
 
. : . : . : . : . : . :
JMSF026F20+ AAGGGCCCAGCTCGTAGAAGTTGGCGAGCATGGAGGAGCAGCCGGGGCCGCCTTGAAGCC
JMSF047C20+ AAGGGCCCAGCTCGTAGAAGTTGGCGAGCATGGAGGAGCAGCCGGGGCCGCCTTGAAGCC
                      ____________________________________________________________
consensus AAGGGCCCAGCTCGTAGAAGTTGGCGAGCATGGAGGAGCAGCCGGGGCCGCCTTGAAGCC
 
. : . : . : . : . : . :
JMSF026F20+ AGATCAGAATCGGAGTCTTGGAGAGAGGGAAAATTGGGTTCTGGGCTTCGTAATAAGTGT
JMSF047C20+ AGATCAGAATCGGAGTCTTGGAGAGAGGGAAAATTGGGTTCTGGGCTTCGTAATAAGTGT
                      ____________________________________________________________
consensus AGATCAGAATCGGAGTCTTGGAGAGAGGGAAAATTGGGTTCTGGGCTTCGTAATAAGTGT
 
. : . : . : . : . : . :
JMSF026F20+ AGAAAATGGCGGAGCCGGTGGTGGAGTTGACCGTAAGGTAGCCGGAGTTGGTGGGAAGGG
JMSF047C20+ AGAAAATGGCGGAGCCGGTGGTGGAGTTGACCGTAAGGTAGCCGGAGTTGGTGGGAAGGG
                      ____________________________________________________________
consensus AGAAAATGGCGGAGCCGGTGGTGGAGTTGACCGTAAGGTAGCCGGAGTTGGTGGGAAGGG
 
. : . : . : . : . : . :
JMSF026F20+ CTTCTTGAGGGAAGGGAGTGGATGATTTGCAAGACGAGTATTCAAAAACAGTGAAGATAA
JMSF047C20+ CTTCTTGAGGGAAGGGAGTGGATGATTTGCAAGACGAGTATTCAAAAACAGTGAAGATAA
                      ____________________________________________________________
consensus CTTCTTGAGGGAAGGGAGTGGATGATTTGCAAGACGAGTATTCAAAAACAGTGAAGATAA
 
. : . : . : . : . : . :
JMSF026F20+ GGAGGTTGAAAAAGAGTGTATGGGTAAGGGATTTGGATGCCATTGATGGATGCGGAGAAG
JMSF047C20+ GGAGGTTGAAAAAGAGTGTATGGGTAAGGGATTTGGATGCCATTGATGGATGCGGAGAAG
                      ____________________________________________________________
consensus GGAGGTTGAAAAAGAGTGTATGGGTAAGGGATTTGGATGCCATTGATGGATGCGGAGAAG
 
. : . : . : . : . : . :
JMSF026F20+ GAAATAGGAAGCAGAGTAGTTTGGC
JMSF047C20+ GAAATAGGAAGCAGAGTAGTTTGGCACTAGTAGCAACTAAAATTCATAGTTTTGACTTCC
                      ____________________________________________________________
consensus GAAATAGGAAGCAGAGTAGTTTGGCACTAGTAGCAACTAAAATTCATAGTTTTGACTTCC