Previous Contig 007767:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035J03Sequence604007767 (17)sp|P23326|RK35_SPIOL3e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos676007767 (17)sp|P23326|RK35_SPIOL7e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMFF036D19Sequence573007767 (17)sp|P23326|RK35_SPIOL6e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos671007767 (17)sp|P23326|RK35_SPIOL9e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMFN009I17Sequence623007767 (17)sp|P23326|RK35_SPIOL8e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMFN020I08Sequence584007767 (17)sp|P23326|RK35_SPIOL7e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMFN032O17Sequence597007767 (17)sp|P23326|RK35_SPIOL7e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMFN039C14Sequence609007767 (17)sp|P23326|RK35_SPIOL7e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMSF026C23Sequence636007767 (17)sp|P23326|RK35_SPIOL8e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos424007767 (17)sp|P23326|RK35_SPIOL4e-2350S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMSF028C23Sequence445007767 (17)sp|P23326|RK35_SPIOL1e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMSF037L05Sequence676007767 (17)sp|P23326|RK35_SPIOL9e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos630007767 (17)sp|P23326|RK35_SPIOL8e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMSF047C15Sequence713007767 (17)sp|P23326|RK35_SPIOL1e-2450S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos695007767 (17)sp|P23326|RK35_SPIOL1e-2450S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos
JMSF049O06Sequence677007767 (17)sp|P23326|RK35_SPIOL9e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos655007767 (17)sp|P23326|RK35_SPIOL8e-2550S ribosomal protein L35, chloroplast precursor (CL35).>pir|A36107|A36107 ribos

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047C15- AGAAGAACACAACTTTGGATATTACAACCAGAAT
JMSF049O06+ TGGATATTACAACCAGAAT
JMSF037L05+ AGAAGAACACAACTTTGGATATTACAACCAGAAT
rJMFF036D19- ACCAGAAT
rJMFF035J03- TTGGATATTACAACCAGAAT
JMSF047C15+ TTAGGAGGGTTACTATATGTAAGAAGAACACAACTTTGGATATTACAACCAGAAT
                      ____________________________________________________________
consensus TTAGGAGGGTTACTATATGTAAGAAGAACACAACTTTGGATATTACAACCAGAAT
 
. : . : . : . : . : . :
JMSF026C23+ AAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
JMFF035J03+ TTCTAGCAAA
rJMSF047C15- CTTGTGCTTTTAACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
rJMSF049O06- TGTGCTTTT-ACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
JMSF049O06+ CTTGTGCTTTTAACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
rJMSF037L05- ACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
rJMSF026C23- ACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
JMSF037L05+ CTTGTGCTTTTAACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
JMFN020I08+ AGAATATAATAATACAAGAATTTCTAGCAAA
JMFN009I17+ AGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
JMFN032O17+ ATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
JMFN039C14+ TGCTTTTAACACATTTGAAGGGTTTAGAATATAATAATACAAGAATTTCTAGCAAA
rJMFF036D19- CTTGTGCTTTTAACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
rJMFF035J03- CTTGTGCTTTTAACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
JMSF047C15+ CTTGTGCTTTTAACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
                      ____________________________________________________________
consensus CTTGTGCTTTTAACACATTTTGAAGGGTTAGAATATAATAATACAAGAATTTCTAGCAAA
 
. : . : . : . : . : . :
JMSF026C23+ GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
JMFF035J03+ GCTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
JMFF036D19+ AGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
rJMSF047C15- GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
rJMSF049O06- GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
JMSF049O06+ GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
rJMSF037L05- GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
rJMSF026C23- GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
JMSF037L05+ GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
JMFN020I08+ GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
rJMSF028C23- AAAAATTGAACTGAGGAGGGTTCATCCATTTACGTGCAAAAGGGGTACAAAG
JMFN009I17+ GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
JMFN032O17+ GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
JMFN039C14+ GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
rJMFF036D19- GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
rJMFF035J03- GCTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
JMSF047C15+ GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
                      ____________________________________________________________
consensus GTTGAAGAAAAAATTGAACTGAGGAGGGTTCATCCATTTAC-TGCAAAAGGGGTACAAAG
 
. : . : . : . : . : . :
JMSF026C23+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
JMFF035J03+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
JMFF036D19+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
rJMSF047C15- GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
rJMSF049O06- GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
JMSF049O06+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
rJMSF037L05- GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
rJMSF026C23- GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
JMSF037L05+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
JMFN020I08+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
rJMSF028C23- GAGAACTCAGGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
JMFN009I17+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
JMFN032O17+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
JMFN039C14+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
rJMFF036D19- GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
rJMFF035J03- GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
JMSF047C15+ GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
                      ____________________________________________________________
consensus GAGAACTCAAGCACTACACTTCCCGCTTTTTTGCATTCTAATTGTCTCGATTCACCTTCA
 
. : . : . : . : . : . :
JMSF026C23+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
JMFF035J03+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
JMFF036D19+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
rJMSF047C15- GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
rJMSF049O06- GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
JMSF049O06+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
rJMSF037L05- GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
rJMSF026C23- GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
JMSF037L05+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
JMFN020I08+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
rJMSF028C23- GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
JMFN009I17+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
JMFN032O17+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
JMFN039C14+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
rJMFF036D19- GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
rJMFF035J03- GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
JMSF047C15+ GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
                      ____________________________________________________________
consensus GATAAGGCAATGCACCAATCACGTTGTTGTAGTCTGTGCGGCTTACTTGTACCATCTTAG
 
. : . : . : . : . : . :
JMSF026C23+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
JMFF035J03+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
JMFF036D19+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
rJMSF047C15- AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
rJMSF049O06- AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
JMSF049O06+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
rJMSF037L05- AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
rJMSF026C23- AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
JMSF037L05+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
JMFN020I08+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
rJMSF028C23- AGAGTCTTAATCTCCGTTTGGNATTCTTCTTCCTAANCAAATGCTGCTTCCCGGCTCTCC
JMFN009I17+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
JMFN032O17+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
JMFN039C14+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
rJMFF036D19- AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
rJMFF035J03- AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
JMSF047C15+ AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
                      ____________________________________________________________
consensus AGAGTCTTAATCTCCGTTTGGTATTCTTCTTCCTAAGCAAATGCTGCTTCCCGGCTCTCC
 
. : . : . : . : . : . :
JMSF026C23+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
JMFF035J03+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
JMFF036D19+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
rJMSF047C15- TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
rJMSF049O06- TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
JMSF049O06+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
rJMSF037L05- TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
rJMSF026C23- TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
JMSF037L05+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
JMFN020I08+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
rJMSF028C23- TCCTCATGATCTTCCCACTCCCGGACACCCNAAACCGCTTCGCGGACGCCTTGTGCGTCT
JMFN009I17+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
JMFN032O17+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
JMFN039C14+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
rJMFF036D19- TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
rJMFF035J03- TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
JMSF047C15+ TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
                      ____________________________________________________________
consensus TCCTCATGATCTTCCCACTCCCGGACACCCGAAACCGCTTCGCGGACGCCTTGTGCGTCT
 
. : . : . : . : . : . :
JMSF026C23+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
JMFF035J03+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGCTTTTTTGCGCCGGGG
JMFF036D19+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
rJMSF047C15- TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
rJMSF049O06- TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
JMSF049O06+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
rJMSF037L05- TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
rJMSF026C23- TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
JMSF037L05+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
JMFN020I08+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
rJMSF028C23- TCATCTTATAGCCTTTCGCGCACACTACGGNGAATGTCCGTGGGGCTTTTTGCGCCGGGG
JMFN009I17+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
JMFN032O17+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
JMFN039C14+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
rJMFF036D19- TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
rJMFF035J03- TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGCTTTTTTGCGCCGGGG
JMSF047C15+ TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
                      ____________________________________________________________
consensus TCATCTTATAGCCTTTCGCGCACACTACGGTGAATGTCCGTGGGGCTTTTTGCGCCGGGG
 
. : . : . : . : . : . :
JMSF026C23+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
JMFF035J03+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
JMFF036D19+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
rJMSF047C15- AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
rJMSF049O06- AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
JMSF049O06+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
rJMSF037L05- AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
rJMSF026C23- AGGGAACACGGCTGAG
JMSF037L05+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
JMFN020I08+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
rJMSF028C23- AGGNAACACGGCTGATAACGAGCGGCGCGNANGTTGAGATGCTGTGTGAANAGCTGANGT
JMFN009I17+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
JMFN032O17+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
JMFN039C14+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
rJMFF036D19- AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
rJMFF035J03- AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
JMSF047C15+ AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
                      ____________________________________________________________
consensus AGGGAACACGGCTGAGAACGAGCGGCGCGGAGGTTGAGATGCTGTGTGAAGAGCTGAGGT
 
. : . : . : . : . : . :
JMSF026C23+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
JMFF035J03+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
JMFF036D19+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
rJMSF047C15- TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
rJMSF049O06- TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
JMSF049O06+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
rJMSF037L05- TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
JMSF037L05+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
JMFN020I08+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
rJMSF028C23- TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGG
JMFN009I17+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
JMFN032O17+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
JMFN039C14+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
rJMFF036D19- TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
rJMFF035J03- TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAGAAGT
JMSF047C15+ TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
                      ____________________________________________________________
consensus TGAGAGTGGGTTTCTTTGTGGAGAGTGAAGGGGTGAGGGAGACTCGAGAGGCGGAG-AGT
 
. : . : . : . : . : . :
JMSF026C23+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
JMFF035J03+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
JMFF036D19+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
rJMSF047C15- GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
rJMSF049O06- GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
JMSF049O06+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
rJMSF037L05- GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
JMSF037L05+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
JMFN020I08+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
JMFN009I17+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
JMFN032O17+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
JMFN039C14+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
rJMFF036D19- GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
rJMFF035J03- GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
JMSF047C15+ GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
                      ____________________________________________________________
consensus GGTGGGGTTCGACAAGAGAAGTTGAATGCCAGAGAACAGTGTAAGGCTAAGGGTGAAGAA
 
. : . : . : . : . : . :
JMSF026C23+ GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTTTCCAATTT
JMFF035J03+ GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTTGCCAATTT
JMFF036D19+ GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTTTCCTATTT
rJMSF047C15- GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTTTCCAATTTGACC
rJMSF049O06- GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTTTCCAATTAGACC
JMSF049O06+ GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTTTCCAATTAGACC
rJMSF037L05- GACGTCATCGCCATTTCTTTGCTGCAATGAAGCT
JMSF037L05+ GACGTCATCGCCATTTCTTTGCTGCAATGAAGCT
JMFN020I08+ GACGTCATCGCCATT
JMFN009I17+ GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTT
JMFN032O17+ GACGTCATCGCCATT
JMFN039C14+ GACGTCATCGCCATT
rJMFF036D19- GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTTT
rJMFF035J03- GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTT
JMSF047C15+ GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTTTCCAATTTGACC
                      ____________________________________________________________
consensus GACGTCATCGCCATTTCTTTGCTGCAATGAAGCTTTGGATAATGGCTTTCCAATTTGACC