Previous Contig 007763:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031N17Sequence616007763 (4)gb:AY221505_15905496e-25Lycopersicon esculentum biotin carboxylase carrier protein (BCCP1) mRNA, complet
JMFS004F11Sequence537007763 (4)gb:AY221505_15905496e-17Lycopersicon esculentum biotin carboxylase carrier protein (BCCP1) mRNA, complet
JMSF002K14Sequence426007763 (4)gb:AY221505_15905497e-05Lycopersicon esculentum biotin carboxylase carrier protein (BCCP1) mRNA, complet310011221 (2)
JMSF047B17Sequence676007763 (4)gb:AY221505_15905493e-23Lycopersicon esculentum biotin carboxylase carrier protein (BCCP1) mRNA, complet738011700 (7)pir|T48868|T488683e-53zinc finger protein [imported] - garden pea>gb:AF160977_1773385 Pisum sativum zi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047B17+ GTATAGCTGGCATGTA
                      ____________________________________________________________
consensus GTATAGCTGGCATGTA
 
. : . : . : . : . : . :
JMFF031N17+ GGAGGAGGAGCAGCAGATGGTGGTTGCAAGGCCTC
JMSF047B17+ GTGTGACTGGACTGGCGGAGTATGAGGAGGAGGAGCAGCAGATGGTGGTTGCAAGGCCTC
                      ____________________________________________________________
consensus GTGTGACTGGACTGGCGGAGTATGAGGAGGAGGAGCAGCAGATGGTGGTTGCAAGGCCTC
 
. : . : . : . : . : . :
JMFS004F11+ CAAGTTGTTTCAACTTGAGCTCCGCAATATCTCT
JMFF031N17+ CTTTTTACGGATTATCAGTTCACAGTCAAGTTGTTTCAACTTGAGCTCCGCAATATCTCT
JMSF047B17+ CTTTTTACGGATTATCAGTTCACAGTCAAGTTGTTTCAACTTGAGCTCCGCAATATCTCT
                      ____________________________________________________________
consensus CTTTTTACGGATTATCAGTTCACAGTCAAGTTGTTTCAACTTGAGCTCCGCAATATCTCT
 
. : . : . : . : . : . :
JMFS004F11+ GGAATCAACTAGCTTGACAAGAGTTGAAACTTGGCTTAGGAACTCAGCTATCGACTCTTC
JMSF002K14+ TCTTC
JMFF031N17+ GGAATCAACTAGCTTGACAAGAGTTGAAACTTGGCTTAGGAACTCAGCTATCGACTCTTC
JMSF047B17+ GGAATCAACTAGCTTGACAAGAGTTGAAACTTGGCTTAGGAACTCAGCTATCGACTCTTC
                      ____________________________________________________________
consensus GGAATCAACTAGCTTGACAAGAGTTGAAACTTGGCTTAGGAACTCAGCTATCGACTCTTC
 
. : . : . : . : . : . :
JMFS004F11+ AGAGGCCAAAACTGCAGGCGAAGTCTCACTCGAGAGCTTGACATCATTGGATGCCGATGA
JMSF002K14+ AGAGGCCAAAACTGCAGGCGAAGTCTCACTCGAGAGCTTGACATCATTGGATGCCGATGA
JMFF031N17+ AGAGGCCAAAACTGCAGGCGAAGTCTCACTCGAGAGCTTGACATCATTGGATGCCGATGA
JMSF047B17+ AGAGGCCAAAACTGCAGGCGAAGTCTCACTCGAGAGCTTGACATCATTGGATGCCGATGA
                      ____________________________________________________________
consensus AGAGGCCAAAACTGCAGGCGAAGTCTCACTCGAGAGCTTGACATCATTGGATGCCGATGA
 
. : . : . : . : . : . :
JMFS004F11+ TACTTCAGGCTCCGGAGGAGTACCAGGTGCAGCATTTGATGATCCATCCACAGAAACCTT
JMSF002K14+ TACTTCAAGCTCCGGAGGAGTACCAGGTGCAGCATTTGATGATCCATCCACAGAAACCTT
JMFF031N17+ TACTTCAGGCTCCGGAGGAGTACCAGGTGCAGCATTTGATGATCCATCCACAGAAACCTT
JMSF047B17+ TACTTCAGGCTCCGGAGGAGTACCAGGTGCAGCATTTGATGATCCATCCACAGAAACCTT
                      ____________________________________________________________
consensus TACTTCAGGCTCCGGAGGAGTACCAGGTGCAGCATTTGATGATCCATCCACAGAAACCTT
 
. : . : . : . : . : . :
JMFS004F11+ ATTCAATTGTGCTTTTGCTACAACAGAGTGATTCCAGTTGGAATGCAAATCCTTAGAAGA
JMSF002K14+ ATTCAATTGTGCTTTTGCTACAACAGAGTGATTCCAGTTGGAATGCAAATCCTTAGAAGA
JMFF031N17+ ATTCAATTGTGCTTTTGCTACAACAGAGTGATTCCAGTTGGAATGCAAATCCTTAGAAGA
JMSF047B17+ ATTCAATTGTGCTTTTGCTACAACAGAGTGATTCCAGTTGGAATGCAAATCCTTAGAAGA
                      ____________________________________________________________
consensus ATTCAATTGTGCTTTTGCTACAACAGAGTGATTCCAGTTGGAATGCAAATCCTTAGAAGA
 
. : . : . : . : . : . :
JMFS004F11+ GGAGAACCGGAGCTTGAGCTTGAGCTTGGGATGAGATTGCGAGTAGTGGTGGCGGAAGAG
JMSF002K14+ GGAGAACCGGAGCTTGAGCTTGAGCTTGGGATGAGATTGCGAGTAGTGGTGGCGGAAGAG
JMFF031N17+ GGAGAACCGGAGCTTGAGCTTGAGCTTGGGATGAGATTGCGAGTAGTGGTGGCGGAAGAG
JMSF047B17+ GGAGAACCGGAGCTTGAGCTTGAGCTTGGGATGAGATTGCGAGTAGTGGTGGCGGAAGAG
                      ____________________________________________________________
consensus GGAGAACCGGAGCTTGAGCTTGAGCTTGGGATGAGATTGCGAGTAGTGGTGGCGGAAGAG
 
. : . : . : . : . : . :
JMFS004F11+ AGGCAAACATTTTGATGAGTTCAGAACATTTCTCGTCGCCGTCGCCGCAGAAGCTGAGGT
JMSF002K14+ AGGCAAACATTTTGATGAGTTCAGAACATTTCTCGTCGCCGTCGCCGCAGAAGCTGAGGT
JMFF031N17+ AGGCAAACATTTTGATGAGTTCAGAACATTTCTCGTCGCCGTCGCCGCAGAAGCTGAGGT
JMSF047B17+ AGGCAAACATTTTGATGAGTTCAGAACATTTCTCGTCGCCGTCGCCGCAGAAGCTGAGGT
                      ____________________________________________________________
consensus AGGCAAACATTTTGATGAGTTCAGAACATTTCTCGTCGCCGTCGCCGCAGAAGCTGAGGT
 
. : . : . : . : . : . :
JMFS004F11+ AGTGGCGGCGGCTGCAGCGGTAGCTCCGACGGAAGTAGCCATTTGGCAAAGAGCTTCAAC
JMSF002K14+ AGTGGCGGCGGCTGCAGCGGTAGCTCCGACGGAAGTAGCCATTTGGCAAAGAGCTTCAAC
JMFF031N17+ AGTGGCGGCGGCTGCAGCGGTAGCTCCGACGGAAGTAGCCATTTGGCAAAGAGCTTCAAC
JMSF047B17+ AGTGGCGGCGGCTGCAGCGGTAGCTCCGACGGAAGTAGCCATTTGGCAAAGAGCTTCAAC
                      ____________________________________________________________
consensus AGTGGCGGCGGCTGCAGCGGTAGCTCCGACGGAAGTAGCCATTTGGCAAAGAGCTTCAAC
 
. : . : . : . : . : . :
JMFS004F11+ AGAAATACAGAAAAAGAGAAGGGATATTTCCTCCGAGAAATTCGATCATCCGAGAGAGAC
JMSF002K14+ AGAAATACAGAAAAAGAGAAGGGATATTTCCTCCGAGAAATTCGATCATCCGAGAGAGA
JMFF031N17+ AGAAATACAGAAAAAGAGAAGGGATATTTCCTCCGAGAAATTCGATCATCCGAGAGAGAC
JMSF047B17+ AGAAATACAGAAAAAGAGAAGGGATATTTCCTCCGAGAAATTCGATCATCCGAGAGAGAC
                      ____________________________________________________________
consensus AGAAATACAGAAAAAGAGAAGGGATATTTCCTCCGAGAAATTCGATCATCCGAGAGAGAC
 
. : . : . : . : . : . :
JMFS004F11+ AGGTGTCGGATAGAGGGAGGTTA
JMFF031N17+ AGGTGTCGGATAGAGGGAGGTTATGATTTATGAAATCCA
JMSF047B17+ AGGTGTCGGATAGAGGGAGGTTATGATTTATGAAATCCAATTGGAAGAGGAACAGAAACC
                      ____________________________________________________________
consensus AGGTGTCGGATAGAGGGAGGTTATGATTTATGAAATCCAATTGGAAGAGGAACAGAAACC