Previous Contig 007761:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011N01Sequence577007761 (6)gb:AY085361_15704322e-15Arabidopsis thaliana clone 14794 mRNA, complete sequence.533007761 (6)gb:AY085361_15704322e-15Arabidopsis thaliana clone 14794 mRNA, complete sequence.
JMSF047B10Sequence653007761 (6)gb:AY085361_15704323e-15Arabidopsis thaliana clone 14794 mRNA, complete sequence.601007761 (6)gb:AY085361_15704322e-15Arabidopsis thaliana clone 14794 mRNA, complete sequence.
JMSF049A09Sequence336007761 (6)gb:AY085361_15704323e-11Arabidopsis thaliana clone 14794 mRNA, complete sequence.481007761 (6)gb:AY085361_15704329e-14Arabidopsis thaliana clone 14794 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF011N01+ GGGGGTCTTCGCGGATCACGATGACCCAACTCCATAATCACATCTCTCC
JMFF011N01- GGGGGTCTTCGCGGATCACGATGACCCAACTCCATAATCACATCTCTCC
rJMSF047B10+ GAGAGGGGGTCTTCGCGGATCACGATGACCCAACTCCATAATCACATCTCTCC
rJMSF049A09+ GAGAGGGGGTCTTCGCGGATCACGATGACCCAACTCCATAATCACATCTCTCC
JMSF049A09- GAGAGGGGGTCTTCGCGGATCACGATGACCCAACTCCATAATCACATCTCTCC
JMSF047B10- GAGAGGGGGTCTTCGCGGATCACGATGACCCAACTCCATAATCACATCTCTCC
                      ____________________________________________________________
consensus GAGAGGGGGTCTTCGCGGATCACGATGACCCAACTCCATAATCACATCTCTCC
 
. : . : . : . : . : . :
rJMFF011N01+ TCCTCAGCCGCCGCCGTCGTCCACCGATGATTCTCGTCCTCCGCCACCGTCAACCTCCGA
JMFF011N01- TCCTCAGCCGCCGCCGTCGTCCACCGATGATTCTCGTCCTCCGCCACCGTCAACCTCCGA
rJMSF047B10+ TCCTCAGCCGCCGCCGTCGTCCACCGATGATTCTCGTCCTCCGCCACCGTCAACCTCCGA
rJMSF049A09+ TCCTCAGCCGCCGCCGTCGTCCACCGATGATTNTCGTCCTCCGCCACCGTCAACCTCCGA
JMSF049A09- TCCTCAGCCGCCGCCGTCGTCCACCGATGATTCTCGTCCTCCGCCACCGTCAACCTCCGA
JMSF047B10- TCCTCAGCCGCCGCCGTCGTCCACCGATGATTCTCGTCCTCCGCCACCGTCAACCTCCGA
                      ____________________________________________________________
consensus TCCTCAGCCGCCGCCGTCGTCCACCGATGATTCTCGTCCTCCGCCACCGTCAACCTCCGA
 
. : . : . : . : . : . :
rJMFF011N01+ TGAGCCCAGTGCTGAGCCTCCCAGAGACGCACCTCCTCCTCCTCGATTCGACCCTAGCCG
JMFF011N01- TGAGCCCAGTGCTGAGCCTCCCAGAGACGCACCTCCTCCTCCTCGATTCGACCCTAGCCG
rJMSF047B10+ TGAGCCCAGTGCTGAGCCTCCCAGAGACGCACCTCCTCCTCCTCGATTCGACCCTAGCCG
rJMSF049A09+ TGAGCCCAGTGNTGAGCCTCCCAGAGACGCACCTCCTCCTCCTCGATTCGACCCTAGCCG
JMSF049A09- TGAGCCCAGTGCTGAGCCTCCCAGAGACGCNCCTCCTCCTCCTCGATTCGACCCTAGCCG
JMSF047B10- TGAGCCCAGTGCTGAGCCTCCCAGAGACGCACCTCCTCCTCCTCGATTCGACCCTAGCCG
                      ____________________________________________________________
consensus TGAGCCCAGTGCTGAGCCTCCCAGAGACGCACCTCCTCCTCCTCGATTCGACCCTAGCCG
 
. : . : . : . : . : . :
rJMFF011N01+ AATGATTGGTATTATTAGAAGGAAGGCATTGATAAAAGATTTGGCAGCCGTATACCATGC
JMFF011N01- AATGATTGGTATTATTAGAAGGAAGGCATTGATAAAAGATTTGGCAGCCGTATACCATGC
rJMSF047B10+ AATGATTGGTATTATTAGAAGGAAGGCATTGATAAAAGATTTGGCAGCCGTATACCATGC
rJMSF049A09+ AATGATTGGTATTATTAGAAGGAAGGCATTGATAAAAGATTTGGCAGCCGTATACCATGC
JMSF049A09- AATGATTGGNATTATTAGAAGGAAGGCATTGATAAAAGATTTGGCAGCCGTATACCATGN
JMSF047B10- AATGATTGGTATTATTAGAAGGAAGGCATTGATAAAAGATTTGGCAGCCGTATACCATGC
                      ____________________________________________________________
consensus AATGATTGGTATTATTAGAAGGAAGGCATTGATAAAAGATTTGGCAGCCGTATACCATGC
 
. : . : . : . : . : . :
rJMFF011N01+ AGAGTGCCTTACATATTGTCAACAACTTTTGGAACTCCAAAGAAAATTTGAAGAGCCACA
JMFF011N01- AGAGTGCCTTACATATTGTCAACAACTTTTGGAACTCCAAAGAAAATTTGAAGAGCCACA
rJMSF047B10+ AGAGTGCCTTACATATTGTCAACAACTTTTGGAACTCCAAAGAAAATTTGAAGAGCCACA
rJMSF049A09+ AGAGTGCCTTACATATNGTCAACAACTTTTGGAACTCCAAAGAAAATTTGAAGAGCCACA
JMSF049A09- NNAGTGCCTTACATATTGNCAACNACTTTTGGAACTCCAAAGAAAATTTGAAGAGCCACA
JMSF047B10- AGAGTGCCTTACATATTGTCAACAACTTTTGGAACTCCAAAGAAAATTTGAAGAGCCACA
                      ____________________________________________________________
consensus AGAGTGCCTTACATATTGTCAACAACTTTTGGAACTCCAAAGAAAATTTGAAGAGCCACA
 
. : . : . : . : . : . :
rJMFF011N01+ TATAGAGATTAAGGCTCCAGAAGACACAAGGAAAGAGATGGCAAGGCCCACAAAGCGCAT
JMFF011N01- TATAGAGATTAAGGCTCCAGAAGACACAAGGAAAGAGATGGCAAGGCCCACAAAGCGCAT
rJMSF047B10+ TATAGAGATTAAGGCTCCAGAAGACACAAGGAAAGAGATGGCAAGGCCCACAAAGCGCAT
rJMSF049A09+ TATAGAGATTAAGGCTCCAGAAGACACAAGGAAAGAGATGGCAAGGCCCACAAAGCGCAT
JMSF049A09- TATANAGATTAAGGCTCCAGAAGACACTAGGAAAGAGATGG
JMSF047B10- TATAGAGATTAAGGCTCCAGAAGACACAAGGAAAGAGATGGCAAGGCCCACAAAGCGCAT
                      ____________________________________________________________
consensus TATAGAGATTAAGGCTCCAGAAGACACAAGGAAAGAGATGGCAAGGCCCACAAAGCGCAT
 
. : . : . : . : . : . :
rJMFF011N01+ GAAGAAAACTCGTTAGGTGTTAAACTTCAAGTGTTTGGCAGCTTGATTCATTCCTTTTTA
JMFF011N01- GAAGAAAACTCGTTAGGTGTTAAACTTCAAGTGTTTGGCAGCTTGATTCATTCCTTTTTA
rJMSF047B10+ GAAGAAAACTCGTTAGGTGTTAAACTTCAAGTGTTTGGCAGCTTGATTCATTCCTTTTTA
rJMSF049A09+ GAAGAAAACTCGTTAGGTGTTAAACTTCAAGTGTTTGGCAGCTTGATTCATTCCTTTTTA
JMSF047B10- GAAGAAAACTCGTTAGGTGTTAAACTTCAAGTGTTTGGCAGCTTGATTCATTCCTTTTTA
                      ____________________________________________________________
consensus GAAGAAAACTCGTTAGGTGTTAAACTTCAAGTGTTTGGCAGCTTGATTCATTCCTTTTTA
 
. : . : . : . : . : . :
rJMFF011N01+ AGATTCACTTCTCTACCCATCTTATCAGCAAGAAATCAAAGCTTATTTGGTATTGTAGAG
JMFF011N01- AGATTCACTTCTCTACCCATCTTATCAGCAAGAAATCAAAGCTTATTTGGTATTGTAGAG
rJMSF047B10+ AGATTCACTTCTCTACCCATCTTATCAGCAAGAAATCAAAGCTTATTTGGTATTGTAGAG
rJMSF049A09+ AGATTCACTTCTCTACCCATCTTATCAGCAAGAAATCAAAGCTTATTTGGTATTGTTGAG
JMSF047B10- AGATTCACTTCTCTACCCATCTTATCAGCAAGAAATCAAAGCTTATTTGGTATTGTAGAG
                      ____________________________________________________________
consensus AGATTCACTTCTCTACCCATCTTATCAGCAAGAAATCAAAGCTTATTTGGTATTGTAGAG
 
. : . : . : . : . : . :
rJMFF011N01+ TTGCCAAAACCAATTGACTGATAAATGAGTAGTTCTAAAACTATAGTCTCCAGAAGTATA
JMFF011N01- TTGCCAAAACCAATTGACTGATAAATGAGTAGTTCTAAAACTATAGTCTCCAGAAGTATA
rJMSF047B10+ TTGCCAAAACCAATTGACTGATAAATGAGTAGTTCTAAAACTATAGTCTCCAGAAGTATA
rJMSF049A09+ TTGCCA
JMSF047B10- TTGCCAAAACCAATTGACTGATAAATGAGTAGTTCTAAAACTATAGTCTCCAGAAGTATA
                      ____________________________________________________________
consensus TTGCCAAAACCAATTGACTGATAAATGAGTAGTTCTAAAACTATAGTCTCCAGAAGTATA
 
. : . : . : . : . : . :
rJMFF011N01+ CTTT
JMFF011N01- CTTTTCATTAGCTTCAAAGAAGTAGTTTTTTCTTGTGGAAA
rJMSF047B10+ CTTTTCATTAGCTTCAAAGAAGTAGTTTTTTCTTGTGGAAATATGCATCTGTTATTTGTA
JMSF047B10- CTTTTCATTAGCTTCAAAGAAGTAGTTTTTTCTTGTGGAAATATGCATCTGTTATTTGTA
                      ____________________________________________________________
consensus CTTTTCATTAGCTTCAAAGAAGTAGTTTTTTCTTGTGGAAATATGCATCTGTTATTTGTA
 
. : . : . : . : . : . :
rJMSF047B10+ CAGACCTT
JMSF047B10- CAGACCTTTTCTAGATAAAATTCTTCAACAATCTATGATTCTTCTCTAACAAAAAAAAAA
                      ____________________________________________________________
consensus CAGACCTTTTCTAGATAAAATTCTTCAACAATCTATGATTCTTCTCTAACAAAAAAAAAA