Previous Contig 007754:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009F04Sequence561007754 (6)pir|T47503|T475031e-52hypothetical protein F9K21.210 - Arabidopsis thaliana>gb:ATF9K21_1551421 Arabido133020843
JMFS081G02Sequence625007754 (6)pir|T47503|T475036e-80hypothetical protein F9K21.210 - Arabidopsis thaliana>gb:ATF9K21_1551421 Arabido
JMSF013I04Sequence222007754 (6)pir|T47503|T475035e-18hypothetical protein F9K21.210 - Arabidopsis thaliana>gb:ATF9K21_1551421 Arabido
JMSF030I19Sequence689007754 (6)pir|T47503|T475032e-72hypothetical protein F9K21.210 - Arabidopsis thaliana>gb:ATF9K21_1551421 Arabido733013405 (3)gb:AB026632_15170192e-12Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F15L12.
JMSF042F07Sequence831007754 (6)pir|T47503|T475034e-95hypothetical protein F9K21.210 - Arabidopsis thaliana>gb:ATF9K21_1551421 Arabido759013405 (3)gb:AB026632_15170194e-13Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F15L12.
JMSF046P06Sequence756007754 (6)pir|T47503|T475032e-72hypothetical protein F9K21.210 - Arabidopsis thaliana>gb:ATF9K21_1551421 Arabido173013405 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042F07+ CCAGTAATT
                      ____________________________________________________________
consensus CCAGTAATT
 
. : . : . : . : . : . :
JMSF042F07+ TGTTGAACCCTGTTCCTAGTATGAATTGCAGCTGTTTCATCTTTACCAAAACTATCTTCA
                      ____________________________________________________________
consensus TGTTGAACCCTGTTCCTAGTATGAATTGCAGCTGTTTCATCTTTACCAAAACTATCTTCA
 
. : . : . : . : . : . :
JMSF042F07+ TCAGCACCAAGGCAATGTAAATATAGACAGGAGGAGTTATTGCAAGGCATGTTTCTCAAC
                      ____________________________________________________________
consensus TCAGCACCAAGGCAATGTAAATATAGACAGGAGGAGTTATTGCAAGGCATGTTTCTCAAC
 
. : . : . : . : . : . :
JMFS081G02+ CTCAAATACCTACCATCCAGGATA
JMSF042F07+ CAGGCATGGCAATATTTTGCAGTTCCAAATGAAGCTCTCAAATACCTACCATCCAGGATA
JMSF030I19+ AAATACCTACCATCCAGGATA
JMSF046P06+ CTCAAATACCTACCATCCAGGATA
                      ____________________________________________________________
consensus CAGGCATGGCAATATTTTGCAGTTCCAAATGAAGCTCTCAAATACCTACCATCCAGGATA
 
. : . : . : . : . : . :
JMFS081G02+ AAACCATGTACTGACTGAATACATCTCACAGCTTCCTCCTCTTTCGAATATGTAATATAT
JMSF042F07+ AAACCATGTACTGACTGAATACATCTCACAGCTTCCTCCTCTTTCGAATATGTAATATAT
JMSF030I19+ AAACCATGTACTGACTGAATACATCTCACAGCTTCCTCCTCTTTCGAATATGTAATATAT
JMSF046P06+ AAACCATGTACTGACTGAATACATCTCACAGCTTCCTCCTCTTTCGAATATGTAATATAT
                      ____________________________________________________________
consensus AAACCATGTACTGACTGAATACATCTCACAGCTTCCTCCTCTTTCGAATATGTAATATAT
 
. : . : . : . : . : . :
JMFS081G02+ ACACTACAGGAATCATTAACGAATTGCTGAACTGCACCACCAGCAGTCCGGGATAGAGAC
JMSF042F07+ ACACTACAGGAATCATTAACGAATTGCTGAACTGCACCACCAGCAGTCCGGGATAGAGAC
JMSF030I19+ ACACTACAGGAATCATTAACGAATTGCTGAACTGCACCACCAGCAGTCCGGGATAGAGAC
JMFF009F04+ ACCAGCAGTCCGGGATAGAGAC
JMSF046P06+ ACACTACAGGAATCATTAACGAATTGCTGAACTGCACCACCAGCAGTCCGGGATAGAGAC
                      ____________________________________________________________
consensus ACACTACAGGAATCATTAACGAATTGCTGAACTGCACCACCAGCAGTCCGGGATAGAGAC
 
. : . : . : . : . : . :
JMFS081G02+ ACCTTGGTAACTTTTCCATACTGACCAAAATACTGTTTTCGCTGCAGCAGATCTTCATCA
JMSF042F07+ ACCTTGGTAACTTTTCCATACTGACCAAAATACTGTTTTCGCTGCAGCAGATCTTCATCA
JMSF030I19+ ACCTTGGTAACTTTTCCATACTGACCAAAATACTGTTTTCGCTGCAGCAGATCTTCATCA
JMFF009F04+ ACCTTGGTAACTTTTCCATACTGACCAAAATACTGTTTTCGCTGCAGCAGATCTTCATCA
JMSF046P06+ ACCTTGGTAACTTTTCCATACTGACCAAAATACTGTTTTCGCTGCAGCAGATCTTCATCA
                      ____________________________________________________________
consensus ACCTTGGTAACTTTTCCATACTGACCAAAATACTGTTTTCGCTGCAGCAGATCTTCATCA
 
. : . : . : . : . : . :
JMFS081G02+ GCAAGACTAAGAGGCAGCCCAATAACATATGCCATTTTCCGTTGAATGACCCTAACATTT
JMSF042F07+ GCAAGACTAAGAGGCAGCCCAATAACATATGCCATTTTCCGTTGAATGACCCTAACATTT
JMSF030I19+ GCAAGACTAAGAGGCAGCCCAATAACATATGCCATTTTCCGTTGAATGACCCTAACATTT
JMFF009F04+ GCAAGACTAAGAGGCAGCCCAATAACATATGCCATTTTCCGTTGAATGACCCTAACATTT
JMSF046P06+ GCAAGACTAAGAGGCAGCCCAATAACATATGCCATTTTCCGTTGAATGACCCTAACATTT
                      ____________________________________________________________
consensus GCAAGACTAAGAGGCAGCCCAATAACATATGCCATTTTCCGTTGAATGACCCTAACATTT
 
. : . : . : . : . : . :
JMFS081G02+ GTAAGATCCTTCTTCACTTCAATAGTTTTAGGTTTTGCCTTTGGTGGTTTGTTTTTCCCA
JMSF042F07+ GTAAGATCCTTCTTCACTTCAATAGTTTTAGGTTTTGCCTTTGGTGGTTTGTTTTTCCCA
JMSF030I19+ GTAAGATCCTTCTTCACTTCAATAGTTTTAGGTTTTGCCTTTGGTGGTTTGTTTTTCCCA
JMFF009F04+ GTAAGATCCTTCTTCACTTCAATAGTTTTAGGTTTTGCCTTTGGTGGTTTGTTTTTCCCA
JMSF046P06+ GTAAGATCCTTCTTCACTTCAATAGTTTTAGGTTTTGCCTTTGGTGGTTTGTTTTTCCCA
                      ____________________________________________________________
consensus GTAAGATCCTTCTTCACTTCAATAGTTTTAGGTTTTGCCTTTGGTGGTTTGTTTTTCCCA
 
. : . : . : . : . : . :
JMFS081G02+ TTTGCATGGCAGCTCGTTACCCTTTCAAAATTTGTTTGCATTGCAACTACTTTTTCCTTT
JMSF042F07+ TTTGCATGGCAGCTCGTTACCCTTTCAAAATTTGTTTGCATTGCAACTACTTTTTCCTTT
JMSF030I19+ TTTGCATGGCAGCTCGTTACCCTTTCAAAATTTGTTTGCATTGCAACTACTTTTTCCTTT
JMFF009F04+ TTTGCATGGCAGCTCGTTACCCTTTCAAAATTTGTTTGCATTGCAACTACTTTTTCCTTT
JMSF046P06+ TTTGCATGGCAGCTCGTTACCCTTTCAAAATTTGTTTGCATTGCAACTACTTTTTCCTTT
                      ____________________________________________________________
consensus TTTGCATGGCAGCTCGTTACCCTTTCAAAATTTGTTTGCATTGCAACTACTTTTTCCTTT
 
. : . : . : . : . : . :
JMFS081G02+ TCATAAATTGATCGACATGCAGGACAACGACCCTCTGTCTCATCTTTCTCTGCCATGTCC
JMSF042F07+ TCATAAATTGATCGACATGCAGGACAACGACCCTCTGTCTCATCTTTCTCTGCCATGTCC
JMSF030I19+ TCATAAATTGATCGACATGCAGGACAACGACCCTCTGTCTCATCTTTCTCTGCCATGTCC
JMSF013I04+ TCTGCCATGTCC
JMFF009F04+ TCATAAATTGATCGACATGCAGGACAACGACCCTCTGTCTCATCTTTCTCTGCCATGTCC
JMSF046P06+ TCATAAATTGATCGACATGCAGGACAACGACCCTCTGTCTCATCTTTCTCTGCCATGTCC
                      ____________________________________________________________
consensus TCATAAATTGATCGACATGCAGGACAACGACCCTCTGTCTCATCTTTCTCTGCCATGTCC
 
. : . : . : . : . : . :
JMFS081G02+ ATTATATGATGCCAACACCACACACAAACCTGGTAACCACATTTGCAAGGCTTGAATTGC
JMSF042F07+ ATTATATGATGCCAACACCACACACAAACCTGGTAACCACATTTGCAAGGCTTGAATTGC
JMSF030I19+ ATTATATGATGCCAACACCACACACAAACCTGGTAACCACATTTGCAAGGCTTGAATTGC
JMSF013I04+ ATTATATGATGCCAACACCACACACAAACCTGGTAACCACATTTGCAAGGCTTGAATTGC
JMFF009F04+ ATTATATGATGCCAACACCACACACAAACCTGGTAACCACATTTGCAAGGCTTGAATTGC
JMSF046P06+ ATTATATGATGCCAACACCACACACAAACCTGGTAACCACATTTGCAAGGCTTGAATTGC
                      ____________________________________________________________
consensus ATTATATGATGCCAACACCACACACAAACCTGGTAACCACATTTGCAAGGCTTGAATTGC
 
. : . : . : . : . : . :
JMFS081G02+ TGATCCGTCCAGTCCATCTCCTCAGCACAAAGAGGACACCTTTTCTCTTCTTCATTGTTC
JMSF042F07+ TGATCCGTCCAGTCCATCTCCTCAGCACAAAGAGGACACCTTTTCTCTTCTTCATTGTTC
JMSF030I19+ TGATCCGTCCAGTCCATCTCCTCAGCACAAAGAGGACACCTTTTCTCTTCTTCATTGTTC
JMSF013I04+ TGATCCGTCCAGTCCATCTCCTCAGCACAAAGAGGACACCTTTTCTCTTCTTCATTGTTC
JMFF009F04+ TGATCCGTCCAGTCCATCTCCTCAGCACAAAGAGGACACCTTTTCTCTTCTTCATTGTTC
JMSF046P06+ TGATCCGTCCAGTCCATCTCCTCAGCACAAAGAGGACACCTTTTCTCTTCTTCATTGTTC
                      ____________________________________________________________
consensus TGATCCGTCCAGTCCATCTCCTCAGCACAAAGAGGACACCTTTTCTCTTCTTCATTGTTC
 
. : . : . : . : . : . :
JMFS081G02+ ATGATTCCCACTGATAAGAGTTT
JMSF042F07+ ATGATTCCCACTGATAAGAGTTTTATTGATTGCCGAAGTCGAAGACAGACGCGAAAAACC
JMSF030I19+ ATGATTCCCACTGATAAGAGTTTTATTGATTGCCGAAGTCGAAGACAGACGCGAAAAACC
JMSF013I04+ ATGATTCCCACTGATAAGAGTTTTATTGATTGCCGAAGTCGAAGACAGACGCGAAAAACC
JMFF009F04+ ATGATTCCCACTGATAAGAGTTTTATTGATTGCCGAAGTCGAAGACAGACGCGAAAAACC
JMSF046P06+ ATGATTCCCACTGATAAGAGTTTTATTGATTGCCGAAGTCGAAGACAGACGCGAAAAACC
                      ____________________________________________________________
consensus ATGATTCCCACTGATAAGAGTTTTATTGATTGCCGAAGTCGAAGACAGACGCGAAAAACC
 
. : . : . : . : . : . :
JMSF042F07+ AACTCTGAGAGACCCAAATAGCGGTGTGCGGCAGCAACCAC
JMSF030I19+ AACTCTGAGAGACCCAAATAGCGGTGTGCGGCAGCAACCACAGGATTGAGACGG
JMSF013I04+ AACTCTGAGAGACCCAAATAGCGGTGTGC
JMFF009F04+ AACTCTGAGAGACCCAAATAGCGGTGTGCGGCAGCAACCACAGGATTGAGACGG
JMSF046P06+ AACTCTGAGAGACCCAAATAGCGGTGTGCGGCAGCAACCACAGGATTGAGACGGCATTTC
                      ____________________________________________________________
consensus AACTCTGAGAGACCCAAATAGCGGTGTGCGGCAGCAACCACAGGATTGAGACGGCATTTC