Previous Contig 007750:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017H04Sequence568007750 (10)gb:AP004187_18387289e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14662007750 (10)gb:AP004187_18387281e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14
JMFN025E20Sequence611007750 (10)gb:AY086797_15718404e-47Arabidopsis thaliana clone 27792 mRNA, complete sequence.
JMFN035M11Sequence600007750 (10)gb:AP004187_18387281e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14
JMFN043C14Sequence593007750 (10)gb:AP004187_18387281e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14
JMSF034C15Sequence656007750 (10)gb:AY086797_15718402e-48Arabidopsis thaliana clone 27792 mRNA, complete sequence.616007750 (10)gb:AY086797_15718402e-48Arabidopsis thaliana clone 27792 mRNA, complete sequence.
JMSF046O11Sequence717007750 (10)gb:AY086797_15718405e-48Arabidopsis thaliana clone 27792 mRNA, complete sequence.547024231gb:AP004187_18387283e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14
JMSF051H06Sequence636007750 (10)gb:AP004187_18387281e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14581007750 (10)gb:AP004187_18387281e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017H04+ GT
rJMSF051H06- AACTTTTTTATGT
JMFN043C14+ CTAGAAAATCAGTTAGAACTGTATATCTAACTTTTTTATGT
                      ____________________________________________________________
consensus CTAGAAAATCAGTTAGAACTGTATATCTAACTTTTTTATGT
 
. : . : . : . : . : . :
JMFF017H04+ TCACATAACAACAAAACTAAGTAAATTCCAACACAAAGATTACAGTAGATACACAACACT
rJMSF051H06- TCACATAACAACAAAACTAAGTAAATTCCAACACAAAGATTACAGTAGATACACAACACT
JMFN043C14+ TCACATAACAACAAAACTAAGTAAATTCCAACACAAAGATTACAGTAGATACACAACACT
                      ____________________________________________________________
consensus TCACATAACAACAAAACTAAGTAAATTCCAACACAAAGATTACAGTAGATACACAACACT
 
. : . : . : . : . : . :
JMFF017H04+ AAAAACAGAGCAAATCAAATCCACTTTAGTGCGGTCACCTCCTTACAGGTGGCACAACAC
rJMSF051H06- AAAAACAGAGCAAATCAAATCCACTTTAGTGCGGTCACCTCCTTACAGGTGGCACAACAC
JMFN035M11- TCACCTCCTTACAGGTGGCACAACAC
JMSF051H06+ TCACCTCCTTACAGGTGGCACAACAC
rJMFF017H04- CCTCCTTACNGGTGGCACAACAC
rJMSF034C15- TCACCTCCTTGCAGGTGGCACAACAC
JMSF034C15+ CACCTCCTTGCAGGTGGCACAACAC
JMFN025E20+ CACCTCCTTACAGGTGGCACAACAC
JMFN043C14+ AAAAACAGAGCAAATCAAATCCACTTTAGTGCGGTCACCTCCTTACAGGTGGCACAACAC
JMSF046O11+ CACCTCCTTACAGGTGGCACAACAC
                      ____________________________________________________________
consensus AAAAACAGAGCAAATCAAATCCACTTTAGTGCGGTCACCTCCTTACAGGTGGCACAACAC
 
. : . : . : . : . : . :
JMFF017H04+ CTCTGCCAGGTGCAGCACCACGACCAGCGGCCTGTGCTTTGGCCCGCATAGCAATAGCAC
rJMSF051H06- CTCTGCCAGGTGCAGCACCACGACCAGCGGCCTGTGCTTTGGCCCGCATAGCAATAGCAC
JMFN035M11- CTCTGCCAGGTGCAGCACCACGACCAGCGGCCTGTGCTTTGGCCCGCATAGCAATAGCAC
JMSF051H06+ CTCTGCCAGGTGCAGCACCACGACCAGCGGCCTGTGCTTTGGCCCGCATAGCAATAGCAC
rJMFF017H04- CTCTGNCAGGTGCAGCACCACGACCAGCGGCCTGTGCTTTGGCCCGCATANCAATAGCAC
rJMSF034C15- CTCTGCCGGGTGCAGCTCCACGACCTGCTGCCTGCGCTTTGGCTCGCATAGCAATTGCAC
JMSF034C15+ CTCTGCCGGGTGCAGCTCCACGACCTGCTGCCTGCGCTTTGGCTCGCATAGCAATTGCAC
JMFN025E20+ CCCTGCCAGGTGCAGCTCCTCGACCTGCAGCCTGCGCTTTGGCTCGCATGGCAATGGCAC
JMFN043C14+ CTCTGCCAGGTGCAGCACCACGACCAGCGGCCTGTGCTTTGGCCCGCATAGCAATAGCAC
JMSF046O11+ CCCTGCCAGGTGCAGCTCCTCGACCTGCAGCCTGCGCTTTGGCTCGCATGGCAATGGCAC
                      ____________________________________________________________
consensus CTCTGCCAGGTGCAGCACCACGACCAGCGGCCTGTGCTTTGGCCCGCATAGCAATAGCAC
 
. : . : . : . : . : . :
JMFF017H04+ GTCCCCGTCCAACTCCAAGTGATGTACCTTTGCCCTTGATTTTAGCTTCTAGACGCTTGA
rJMSF051H06- GTCCCCGTCCAACTCCAAGTGATGTACCTTTGCCCTTGATTTTAGCTTCTAGACGCTTGA
JMFN035M11- GTCCCCGTCCAACTCCAAGTGATGTACCTTTGCCCTTGATTTTAGCTTCTAGACGCTTGA
JMSF051H06+ GTCCCCGTCCAACTCCAAGTGATGTACCTTTGCCCTTGATTTTAGCTTCTAGACGCTTGA
rJMFF017H04- GTCCCCGTCCAACTCCNAGNGATGTACCTTTGCCCTTGATTTTANCTTCTANACGCTTGA
rJMSF034C15- GCCCCCTTCCAACTCCAAGTGATGTACCTTTACCCTTGATTTTAGCTTCTAGGCGCTTAA
JMSF034C15+ GCCCCCTTCCAACTCCAAGTGATGTACCTTTACCCTTGATTTTAGCTTCTAGGCGCTTAA
JMFN025E20+ GTCCTCGTCCAACTCCGAGTGATGTACCTTTGCCCTTGATTTTAGCGTCTAGACGCTTGA
JMFN043C14+ GTCCCCGTCCAACTCCAAGTGATGTACCTTTGCCCTTGATTTTAGCTTCTAGACGCTTGA
JMSF046O11+ GTCCTCGTCCAACTCCGAGTGATGTACCTTTGCCCTTGATTTTAGCGTCTAGACGCTTGA
                      ____________________________________________________________
consensus GTCCCCGTCCAACTCCAAGTGATGTACCTTTGCCCTTGATTTTAGCTTCTAGACGCTTGA
 
. : . : . : . : . : . :
JMFF017H04+ ACATAGGAGCATTCTTAAGCATATCAGGAATTATCATGAACCTGACTTTGCTGCCTCGAA
rJMSF051H06- ACATAGGAGCATTCTTAAGCATATCAGGAATTATCATGAACCTGACTTTGCTGCCTCGAA
JMFN035M11- ACATAGGAGCATTCTTAAGCATATCAGGAATTATCATGAACCTGACTTTGCTGCCTCGAA
JMSF051H06+ ACATAGGAGCATTCTTAAGCATATCAGGAATTATCATGAACCTGACTTTGCTGCCTCGAA
rJMFF017H04- ACATAGGAGCATTCTTAAGCATATCANGAATTATCATGAACCTGACTTTGCTGCCTCNAA
rJMSF034C15- ACATAGGAGCATTCTTAAGCATATCAGGAATAATCATGAACCTGACTTTGCTGCCTCGTA
JMSF034C15+ ACATAGGAGCATTCTTAAGCATATCAGGAATAATCATGAACCTGACTTTGCTGCCTCGTA
JMFN025E20+ ACATAGGAGCATTCTTAAGCATATCAGGAATTATCATGAATCTGACTTTGCTTCCTCGAA
JMFN043C14+ ACATAGGAGCATTCTTAAGCATATCAGGAATTATCATGAACCTGACTTTGCTGCCTCGAA
JMSF046O11+ ACATAGGAGCATTCTTAAGCATATCAGGAATTATCATGAATCTGACTTTGCTTCCTCGAA
                      ____________________________________________________________
consensus ACATAGGAGCATTCTTAAGCATATCAGGAATTATCATGAACCTGACTTTGCTGCCTCGAA
 
. : . : . : . : . : . :
JMFF017H04+ TAAAAACATGCTCAAGTTGTGAAACTCTTCCATCTTTAGCTGTGTAAGTGATGCTCTCGA
rJMSF051H06- TAAAAACATGCTCAAGTTGTGAAACTCTTCCATCTTTAGCTGTGTAAGTGATGCTCTCGA
JMFN035M11- TAAAAACATGCTCAAGTTGTGAAACTCTTCCATCTTTAGCTGTGTAAGTGATGCTCTCGA
JMSF051H06+ TAAAAACATGCTCAAGTTGTGAAACTCTTCCATCTTTAGCTGTGTAAGTGATGCTCTCGA
rJMFF017H04- TAAAANCATGCTCAAGNTGNGAAACTCTTCCATCTTTAGCTGNGTAAGNGATGCTCTCGA
rJMSF034C15- TAAAAACATGCTCCAGTTGTGAGACCCTTCCATCCTTAGCAGTGTAAGTGATGCTCTCAA
JMSF034C15+ TAAAAACATGCTCCAGTTGTGAGACCCTTCCATCCTTAGCAGTGTAAGTGATGCTCTCAA
JMFN025E20+ TAAAAACATGTTCAAGTTGTGAAACGCTTCCATCTTTGGCAGTGTAAGTGATGCTCTCCA
JMFN043C14+ TAAAAACATGCTCAAGTTGTGAAACTCTTCCATCTTTAGCTGTGTAAGTGATGCTCTCGA
JMSF046O11+ TAAAAACATGTTCAAGTTGTGAAACGCTTCCATCTTTGGCAGTGTAAGTGATGCTCTCCA
                      ____________________________________________________________
consensus TAAAAACATGCTCAAGTTGTGAAACTCTTCCATCTTTAGCTGTGTAAGTGATGCTCTCGA
 
. : . : . : . : . : . :
JMFF017H04+ GCTGGCAATTCCAGTTGTCCTCGCACTCCACCATGCTTCCTCTGTAGAGCTCGCCGCTCT
rJMSF051H06- GCTGGCAATTCCAGTTGTCCTCGCACTCCACCATGCTTCCTCTGTAGAGCTCGCCGCTCT
JMFN035M11- GCTGGCAATTCCAGTTGTCCTCGCACTCCACCATGCTTCCTCTGTAGAGCTCGCCGCTCT
JMSF051H06+ GCTGGCAATTCCAGTTGTCCTCGCACTCCACCATGCTTCCTCTGTAGAGCTCGCCGCTCT
rJMFF017H04- GCTGGNAATTCCAGTTGTCCTCGCACTCCANCATGCTTCNTCTGTANAGCTCGCCGCTCT
rJMSF034C15- GCTGGCAATTCCAGTTGTCCTCGCACTCCACCATGCTTCCCCTGTAGAGCTCGCCGCTCT
JMSF034C15+ GCTGGCAATTCCAGTTGTCCTCGCACTCCACCATGCTTCCCCTGTAGAGCTCGCCGCTCT
JMFN025E20+ GTTGGCAGTTCCAGTTGTCCTCGCACTCCACCATGCTTCCTCTGTAGAGCTCGCCGCTCT
JMFN043C14+ GCTGGCAATTCCAGTTGTCCTCGCACTCCACCATGCTTCCTCTGTAGAGCTCGCCGCTCT
JMSF046O11+ GTTGGCAGTTCCAGTTGTCCTCGCACTCCACCATGCTTCCTCTGTAGAGCTCGCCGCTCT
                      ____________________________________________________________
consensus GCTGGCAATTCCAGTTGTCCTCGCACTCCACCATGCTTCCTCTGTAGAGCTCGCCGCTCT
 
. : . : . : . : . : . :
JMFF017H04+ TCATCTCCACCGTCACAATGTGCCCCGTCGCCTCGTGGAGAAGCTTCACCGGGATCCCCA
rJMSF051H06- TCATCTCCACCGTCACAATGTGCCCCGTCGCCTCGTGGAGAAGCTTCACCGGGATCCCCA
JMFN035M11- TCATCTCCACCGTCACAATGTGCCCCGTCGCCTCGTGGAGAAGCTTCACCGGGATCCCCA
JMSF051H06+ TCATCTCCACCGTCACAATGTGCCCCGTCGCCTCGTGGAGAAGCTTCACCGGGATCCCCA
rJMFF017H04- TCATCTCCACCGTCANAATGTGCCCCGTCGCCTCNTGGAGAAGCTTCACCGGGATCCCCA
rJMSF034C15- TCATTTCCACAGTCACGATGTGCCCCGTCGCCTCGTGGAGAAGCTTCACCGGGATCCCCA
JMSF034C15+ TCATTTCCACAGTCACGATGTGCCCCGTCGCCTCGTGGAGAAGCTTCACCGGGATCCCCA
JMFN025E20+ TCATCTCCACGGTGACGACGTGCCCCGTCGACTCGTGTAGAAGCTTCACCGGGATTCCCA
JMFN043C14+ TCATCTCCACCGTCACAATGTGCCCCGTCGCCTCGTGGAGAAGCTTCACCGGGATCCCCA
JMSF046O11+ TCATCTCCACGGTGACGACGTGCCCCGTCGACTCGTGTAGAAGCTTCACCGGGATTCCCA
                      ____________________________________________________________
consensus TCATCTCCACCGTCACAATGTGCCCCGTCGCCTCGTGGAGAAGCTTCACCGGGATCCCCA
 
. : . : . : . : . : . :
JMFF017H04+ AGCTCCTACTCATCGTC
rJMSF051H06- AGCTCCTACTCATCGTC
JMFN035M11- AGCTCCTACTCATCGTCAC-TGCTCTTTCGCCGGG
JMSF051H06+ AGCTCCTACTCATCGTC
rJMFF017H04- AGCTCCTACTCATCGTNAC-TGCTCTTTCGNCGGGACTTTTACTCCGAGA
rJMSF034C15- AGCTCCGACTCATCGT
JMSF034C15+ AGCTCCGACTCATCGT
JMFN025E20+ AGCT
JMFN043C14+ AGCTCCTACTCATCGTCAC-TGCTCTTTCGCCGGGACTTTTACTCCGAGAGAAAAACCTA
JMSF046O11+ AGCTACGACTCATCGTCGCAAGAAACTCCGGCGTGGGTCAGATTTGGATATATAAACAAT
                      ____________________________________________________________
consensus AGCTCCTACTCATCGTCAC-TGCTCTTTCGCCGGGACTTTTACTCCGAGATATAAACCTT
 
. : . : . : . : . : . :
JMFN043C14+ GTGCTGTAAGCCT
JMSF046O11+ ATGC--TCCGCTTGTGTTAGTCCCACAACGTCTCACGAACAGTGACCCGTGTACTCCGTC
                      ____________________________________________________________
consensus GTGCTGTCCGCTTGTGTTAGTCCCACAACGTCTCACGAACAGTGACCCGTGTACTCCGTC