Previous Contig 007747:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024G10Sequence669007747 (7)gb:BT004332_16374041e-91Arabidopsis thaliana clone RAFL15-45-M16 (R50189) unknown protein (At3g09350) mR783007747 (7)gb:BT004332_16374048e-66Arabidopsis thaliana clone RAFL15-45-M16 (R50189) unknown protein (At3g09350) mR
JMSF032A16Sequence660007747 (7)gb:BT004332_16374046e-61Arabidopsis thaliana clone RAFL15-45-M16 (R50189) unknown protein (At3g09350) mR742007747 (7)gb:BT004332_16374044e-53Arabidopsis thaliana clone RAFL15-45-M16 (R50189) unknown protein (At3g09350) mR
JMSF046E02Sequence707007747 (7)gb:BT004332_16374044e-66Arabidopsis thaliana clone RAFL15-45-M16 (R50189) unknown protein (At3g09350) mR
JMSF046O02Sequence727007747 (7)gb:BT004332_16374048e-52Arabidopsis thaliana clone RAFL15-45-M16 (R50189) unknown protein (At3g09350) mR721007747 (7)gb:BT004332_16374042e-59Arabidopsis thaliana clone RAFL15-45-M16 (R50189) unknown protein (At3g09350) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032A16- CATTCAATGCACTGCAAATATTTCATAAA
                      ____________________________________________________________
consensus CATTCAATGCACTGCAAATATTTCATAAA
 
. : . : . : . : . : . :
rJMSF032A16- ACAAAGCTGGTAATACAACTGGGCCAGACAAGAAAAGGTTATATTCCATGAATAGATGCA
rJMSF046O02- AGAAAAGGTTATATTCCATGAATAGATGCA
rJMSF024G10- GGTAATACAACTGGGCCAGACAAGAAAAGGTTACATTCCATGAATAGATGCA
                      ____________________________________________________________
consensus ACAAAGCTGGTAATACAACTGGGCCAGACAAGAAAAGGTTATATTCCATGAATAGATGCA
 
. : . : . : . : . : . :
rJMSF032A16- ATATTTTACATGGTCTCAGACATCATAG-TCGAATAGTACAAACTAGGAACTTCATGTGG
rJMSF046O02- ATATTTTACATGGTCTCAGACATCATAGNTCGAATAGTACAAACTAGGAACTTCATGTGG
rJMSF024G10- ATATTTTACATGGTCTCAGACATCATAG-TCGAATAGTACAAACTAGGAACTTCATGTGG
                      ____________________________________________________________
consensus ATATTTTACATGGTCTCAGACATCATAG-TCGAATAGTACAAACTAGGAACTTCATGTGG
 
. : . : . : . : . : . :
rJMSF032A16- AAGGATTTGTATCTTCATCTCTGACCATGGATCCATTGGAGCTACTTTGTGCTGAAGCAT
rJMSF046O02- AAGGATTTGTATCTTCATCTCTGACCATGGATCCATTGGAGCTACTTTGTGCTGAAGCAT
rJMSF024G10- AAGGATTTGTATCTTCATCTCTGACCATGGATCCATTGGAGCTACTTTGTGCTGAAGCAT
                      ____________________________________________________________
consensus AAGGATTTGTATCTTCATCTCTGACCATGGATCCATTGGAGCTACTTTGTGCTGAAGCAT
 
. : . : . : . : . : . :
rJMSF032A16- CATCTACTGGAGGGACCCAGTCCTAGCAATAGCGGGGTCTCCTTTTCAGTACTAGCCTTT
rJMSF046O02- CATCTACTGGAGGGACCCAGTCCTAGCAATAGCGGGGTCTCCTTTTCAGTACTAGCCTTT
rJMSF024G10- CATCTACTGGAGGGACCCAGTCCTAGCAATAGCGGGGTCTCCTTTTCAGTACTAGCCTTT
                      ____________________________________________________________
consensus CATCTACTGGAGGGACCCAGTCCTAGCAATAGCGGGGTCTCCTTTTCAGTACTAGCCTTT
 
. : . : . : . : . : . :
rJMSF032A16- GTATCTGTATTCCTATTTGCTGCCCAAGCCCTAAGAGGCGGTTCAAAATGCTTACTGGCA
rJMSF046O02- GTATCTGTATTCCTATTTGCTGCCCAAGCCCTAAGAGGCGGTTCAAAATGCTTACTGGCA
rJMSF024G10- GTATCTGTATTCCTATTTGCTGCCCAAGCCCTAAGAGGCGGTTCAAAATGCTTACTGGCA
                      ____________________________________________________________
consensus GTATCTGTATTCCTATTTGCTGCCCAAGCCCTAAGAGGCGGTTCAAAATGCTTACTGGCA
 
. : . : . : . : . : . :
rJMSF032A16- ACGTCTGGTGGTGGTTCATCTTCCCCTGGGAGAACAAGGAGTCCCTTCTCACGAAGGGAA
rJMSF046O02- ACGTCTGGTGGTGGTTCATCTTCCCCTGGGAGAACAAGGAGTCCCTTCTCACGAAGGGAA
rJMSF024G10- ACGTCTGGTGGTGGTTCATCTTCCCCTGGGAGAACAAGGAGTCCCTTCTCACGAAGGGAA
                      ____________________________________________________________
consensus ACGTCTGGTGGTGGTTCATCTTCCCCTGGGAGAACAAGGAGTCCCTTCTCACGAAGGGAA
 
. : . : . : . : . : . :
rJMSF032A16- GATGGCTCATTATAGCAGGCACTCCAAAGGGAATCCACCAGTTGCCTTTCCTCTCTCGCA
rJMSF046O02- GATGGCTCATTATAGCAGGCACTCCAAAGGGAATCCACCAGTTGCCTTTCCTCTCTCGCA
rJMSF024G10- GATGGCTCATTATAGCAGGCACTCCAAAGGGAATCCACCAGTTGCCTTTCCTCTCTCGCA
                      ____________________________________________________________
consensus GATGGCTCATTATAGCAGGCACTCCAAAGGGAATCCACCAGTTGCCTTTCCTCTCTCGCA
 
. : . : . : . : . : . :
rJMSF032A16- GCACCGAGATCTTCAGGGGACATCAAGCTGATCCCATCAATTCGTTGTTGTAGTAATTGT
rJMSF046O02- GCACCGAGATCTTCAGGGGACATCAAGCTGATCCCATCAATTCGTTGTTGTAGTAATTGT
rJMSF024G10- GCACCGAGATCTTCAGGGGACATCAAGCTGATCCCATCAATTCGTTGTTGTAGTAATTGT
                      ____________________________________________________________
consensus GCACCGAGATCTTCAGGGGACATCAAGCTGATCCCATCAATTCGTTGTTGTAGTAATTGT
 
. : . : . : . : . : . :
rJMSF032A16- TTGAGTTTCTCATCGTCCACTCTTAAAGAACCATCTGTTTGTCCTGTGTTGACCCGTGTC
rJMSF046O02- TTGAGTTTCTCATCGTCCACTCTTAAAGAACCATCTGTTTGTCCTGTGTTGACCCGTGTC
rJMSF024G10- TTGAGTTTCTCATCGTCCACTCTTAAAGAACCATCTGTTTGTCCTGTGTTGACCCGTGTC
                      ____________________________________________________________
consensus TTGAGTTTCTCATCGTCCACTCTTAAAGAACCATCTGTTTGTCCTGTGTTGACCCGTGTC
 
. : . : . : . : . : . :
rJMSF032A16- AGCTCAAGAAGGCCTTGAAGTGCACCCTCTCTTACCTCCCCATCCTCACTGGAGGCAAGA
rJMSF046O02- AGCTCAAGAAGGCCTTGAAGTGCACCCTCTCTTACCTCCCCATCCTCACTGGAGGCAAGA
rJMSF024G10- AGCTCAAGAAGGCCTTGAAGTGCACCCTCTCTTACCTCCCCATCCTCACTGGAGGCAAGA
                      ____________________________________________________________
consensus AGCTCAAGAAGGCCTTGAAGTGCACCCTCTCTTACCTCCCCATCCTCACTGGAGGCAAGA
 
. : . : . : . : . : . :
rJMSF032A16- TGCATCAGAATGCGGGGGAATCCTAGCTCAGTGACAACATTGCAATCTGAATGATTCTCA
rJMSF046O02- TGCATCAGAATGCGGGGGAATCCTAGCTCAGTGACAACATTGCAATCTGAATGATTCTCA
rJMSF024G10- TGCATCAGAATGCGGGGGAATCCTAGCTCAGTGACAACATTGCAATCTGAATGATTCTCA
                      ____________________________________________________________
consensus TGCATCAGAATGCGGGGGAATCCTAGCTCAGTGACAACATTGCAATCTGAATGATTCTCA
 
. : . : . : . : . : . :
rJMSF032A16- CGCAGCANGTAATGAAACAAGTTCAGGGCTTTCCTTTGAAACCTCGCGCTCTCA
rJMSF046O02- CGCAGCAAGTAATGAAACAAGTTCAGGGCTTTCCTTTGAAACCTCGCGCTCTCAGAACCT
rJMSF024G10- CGCAGCAAGTAATGAAACAAGTTCAGGGCTTTCCTTTGAAACCTCGCGCTCTCAGAACCT
JMSF024G10+ TTTGAAACCTCGCGCTCTCAGAACCT
                      ____________________________________________________________
consensus CGCAGCAAGTAATGAAACAAGTTCAGGGCTTTCCTTTGAAACCTCGCGCTCTCAGAACCT
 
. : . : . : . : . : . :
rJMSF046O02- AAAGCATCTCTCAATGCTGCATAACCATTTG
rJMSF024G10- AAAGCATCTCTCAATGCTGCATAACCATTTGCAAGGCGGAATGCAGCAATCCCAGGTTTA
JMSF024G10+ AAAGCATCTCTCAATGCTGCATAACCATTTGCAAGGCGGAATGCAGCAATCCCAGGTTTA
                      ____________________________________________________________
consensus AAAGCATCTCTCAATGCTGCATAACCATTTGCAAGGCGGAATGCAGCAATCCCAGGTTTA
 
. : . : . : . : . : . :
rJMSF024G10- TTGTGC
JMSF024G10+ TTGTGCCTGATAAGAGATGAGATGGCACTCAGAGCCTTTGTGCGAACAGTAACATCAGCA
                      ____________________________________________________________
consensus TTGTGCCTGATAAGAGATGAGATGGCACTCAGAGCCTTTGTGCGAACAGTAACATCAGCA
 
. : . : . : . : . : . :
JMSF024G10+ TCTGAAGTAAAATTTGAGAGAAGGGGCTCTAGGCCATTAGCTTCCATCACCAGTTGCTGG
JMSF046E02+ AGAGAAGGGGCTNTAGGCCATTAGCTTCCATCACCAGTTGCTGG
                      ____________________________________________________________
consensus TCTGAAGTAAAATTTGAGAGAAGGGGCTCTAGGCCATTAGCTTCCATCACCAGTTGCTGG
 
. : . : . : . : . : . :
JMSF024G10+ CTCCTGGGATTGTTCTGAACAATTGTACTTACAACTTCTGCAGCCTTAGCTCTGATATTA
JMSF032A16+ CCTGGGATTGTTCTGAACAATTGTACTTACAACTTCTGCAGCCTTAGCTCTGATATTA
JMSF046E02+ CTCCTGGGATTGTTCTGAACAATTGTACTTACAACTTCTGCAGCCTTAGCTCTGATATTA
JMSF046O02+ GATATTA
                      ____________________________________________________________
consensus CTCCTGGGATTGTTCTGAACAATTGTACTTACAACTTCTGCAGCCTTAGCTCTGATATTA
 
. : . : . : . : . : . :
JMSF024G10+ GCATGGGAGTTCCTCAAGTAACCAAGGAGAGGCACCAACCCACCAATTGAATGAAGATCA
JMSF032A16+ GCATGGGAGTTCCTCAAGTAACCAAGGAGAGGCACCAACCCACCAATTGAATGAAGATCA
JMSF046E02+ GCATGGGAGTTCCTCAAGTAACCAAGGAGAGGCACCAACCCACCAATTGAATGAAGATCA
JMSF046O02+ GCATGGGAGTTCCTCAAGTAACCAAGGAGAGGCACCAACCCACCAATTGAATGAAGATCA
                      ____________________________________________________________
consensus GCATGGGAGTTCCTCAAGTAACCAAGGAGAGGCACCAACCCACCAATTGAATGAAGATCA
 
. : . : . : . : . : . :
JMSF024G10+ TTGGCCATGTCAATGGACTCGACATGCTCTTGCAGTTCATCCAACATATCTTCAATATCC
JMSF032A16+ TTGGCCATGTCAATGGACTCGACATGCTCTTGCAGTTCATCCAACATATCTTCAATATCC
JMSF046E02+ TTGGCCATGTCAATGGACTCGACATGCTCTTGCAGTTCATCCAACATATCTTCAATATCC
JMSF046O02+ TTGGCCATGTCAATGGACTCGACATGCTCTTGCAGTTCATCCAACATATCTTCAATATCC
                      ____________________________________________________________
consensus TTGGCCATGTCAATGGACTCGACATGCTCTTGCAGTTCATCCAACATATCTTCAATATCC
 
. : . : . : . : . : . :
JMSF024G10+ TGGGGAGTAATCCCTTGTGACTCAAGCACCTGCTCTGGAGTTTGCATTACAAGAGAAATC
JMSF032A16+ TGGGGAGTAATCCCTTGTGACTCAAGCACCTGCTCTGGAGTTTGCATTACAAGAGAAATC
JMSF046E02+ TGGGGAGTAATCCCTTGTGACTCAAGCACCTGCTCTGGAGTTTGCATTACAAGAGAAATC
JMSF046O02+ TGGGGAGTAATCCCTTGTGACTCAAGCACCTGCTCTGGAGTTTGCATTACAAGAGAAATC
                      ____________________________________________________________
consensus TGGGGAGTAATCCCTTGTGACTCAAGCACCTGCTCTGGAGTTTGCATTACAAGAGAAATC
 
. : . : . : . : . : . :
JMSF024G10+ TCCTTCATTCGCTTCAAGACATCAACAGTTTGAGCTTGCATAGCCTCCATAAACCATTTC
JMSF032A16+ TCCTTCATTCGCTTCAAGACATCAACAGTTTGAGCTTGCATAGCCTCCATAAACCATTTC
JMSF046E02+ TCCTTCATTCGCTTCAAGACATCAACAGTTTGAGCTTGCATAGCCTCCATAAACCATTTC
JMSF046O02+ TCCTTCATTCGCTTCAAGACATCAACAGTTTGAGCTTGCATAGCCTCCATAAACCATTTC
                      ____________________________________________________________
consensus TCCTTCATTCGCTTCAAGACATCAACAGTTTGAGCTTGCATAGCCTCCATAAACCATTTC
 
. : . : . : . : . : . :
JMSF024G10+ CGATCCTCCTCACTCAGGTTACGAGAAGAGTGAGTACCATCAGCATGGGAGAGACTCCAT
JMSF032A16+ CGATCCTCCTCACTCAGGTTACGAGAAGAGTGAGTACCATCAGCATGGGAGAGACTCCAT
JMSF046E02+ CGATCCTCCTCACTCAGGTTACGAGAAGAGTGAGTACCATCAGCATGGGAGAGACTCCAT
JMSF046O02+ CGATCCTCCTCACTCAGGTTACGAGAAGAGTGAGTACCATCAGCATGGGAGAGACTCCAT
                      ____________________________________________________________
consensus CGATCCTCCTCACTCAGGTTACGAGAAGAGTGAGTACCATCAGCATGGGAGAGACTCCAT
 
. : . : . : . : . : . :
JMSF024G10+ TTAAGCAAACCCTCCCAGTTAGGTCCCTCTTTCGCCATTTATATTCAGCTGTAGTATCAA
JMSF032A16+ TTAAGCAAACCCTCCCAGTTAGGTCCCTCTTTCGCCATTTATATTCAGCTGTAGTATCAA
JMSF046E02+ TTAAGCAAACCCTCCCAGTTAGGTCCCTCTTTCGCCATTTATATTCAGCTGTAGTATCAA
JMSF046O02+ TTAAGCAAACCCTCCCAGTTAGGTCCCTCTTTCGCCATTTATATTCAGCTGTAGTATCAA
                      ____________________________________________________________
consensus TTAAGCAAACCCTCCCAGTTAGGTCCCTCTTTCGCCATTTATATTCAGCTGTAGTATCAA
 
. : . : . : . : . : . :
JMSF024G10+ AAACCCTAATGAAGTGTTTGAGAATTCAATGGGAGCAAAAAG
JMSF032A16+ AAACCCTAATGAAGTGTTTGAGAATTCAATGGGAGCAAAAAGAAAATAGAATTGTAGGAA
JMSF046E02+ AAACCCTAATGAAGTGTTTGAGAATTCAATGGGAGCAAAAAGAAAATAGAATTGTAGGAA
JMSF046O02+ AAACCCTAATGAAGTGTTTGAGAATTCAATGGGAGCAAAAAGAAAATAGAATTGTAGGAA
                      ____________________________________________________________
consensus AAACCCTAATGAAGTGTTTGAGAATTCAATGGGAGCAAAAAGAAAATAGAATTGTAGGAA
 
. : . : . : . : . : . :
JMSF032A16+ TGAAGATTATAGTTATATAGACACAGATCGCGCTCAAGTGCTTTTGGATCGAGAAGTTTC
JMSF046E02+ TGAAGATTATAGTTATATAGACACAGATCGCGCTCAAGTGCTTTTGGATCGAGAAGTTTC
JMSF046O02+ TGAAGATTATAGTTATATAGACACAGATCGCGCTCAAGTGCTTTTGGATCGAGAAGTTTC
                      ____________________________________________________________
consensus TGAAGATTATAGTTATATAGACACAGATCGCGCTCAAGTGCTTTTGGATCGAGAAGTTTC
 
. : . : . : . : . : . :
JMSF032A16+ TGGAGCTTTAAGAATAATCCAGTGTTTTCGGGCGACGGACGACTGGGCGATGAATTGAGG
JMSF046E02+ TGGAGCTTTAAGAATAATCCAGTGTTTTCGGGCGACGGACGACTGGGCGATGAATTGAGG
JMSF046O02+ TGGAGCTTTAAGAATAATCCAGTGTTTTCGGGCGACGGACGACTGGGCGATGAATTGAGG
                      ____________________________________________________________
consensus TGGAGCTTTAAGAATAATCCAGTGTTTTCGGGCGACGGACGACTGGGCGATGAATTGAGG
 
. : . : . : . : . : . :
JMSF032A16+ AAACACGTACATGCTGTACAGCGTGAACTCTGCAGAAGCTCGTAAAAGATTGGGATGGGC
JMSF046E02+ AAACACGTACATGCTGTACAGCGTGAACTCTGCAGAAGCTCGTAAAAGATTGGGATGGGC
JMSF046O02+ AAACACGTACATGCTGTACAGCGTGAACTCTGCAGAAGCTCGTAAAAGATTGGGATGGGC
                      ____________________________________________________________
consensus AAACACGTACATGCTGTACAGCGTGAACTCTGCAGAAGCTCGTAAAAGATTGGGATGGGC
 
. : . : . : . : . : . :
JMSF032A16+ C
JMSF046E02+ C
JMSF046O02+ CTAAATCTGTAAACCCAATTTCCCGTATTAAAACTTCAAGGAGTTCAAGCCTGTTTAGCA
                      ____________________________________________________________
consensus CTAAATCTGTAAACCCAATTTCCCGTATTAAAACTTCAAGGAGTTCAAGCCTGTTTAGCA
 
. : . : . : . : . : . :
JMSF046O02+ TGGCAAAGCATTTCCAAATCCAGACGTTATGCCATGGAACCGTGTTCACCATGAATGGCC
                      ____________________________________________________________
consensus TGGCAAAGCATTTCCAAATCCAGACGTTATGCCATGGAACCGTGTTCACCATGAATGGCC