Previous Contig 007742:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS148E02Sequence626007742 (3)pir|D86221|D862215e-46hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889899 Arabid
JMSF015I12Sequence522007742 (3)pir|D86221|D862214e-37hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889899 Arabid724013674 (2)pir|D86221|D862211e-69hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889899 Arabid
JMSF046M06Sequence501007742 (3)pir|D86221|D862212e-26hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889899 Arabid654013674 (2)pir|D86221|D862212e-63hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889899 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS148E02+ GGCTGTCAAGTAAAACATAACATCCCTCACAAACGGGGCCGGAT
                      ____________________________________________________________
consensus GGCTGTCAAGTAAAACATAACATCCCTCACAAACGGGGCCGGAT
 
. : . : . : . : . : . :
JMFS148E02+ CGACCGGAAAGGGCGCGGCATAAATGGACACGAAGCCCACAACAAAAGCCGAGACAAAAG
                      ____________________________________________________________
consensus CGACCGGAAAGGGCGCGGCATAAATGGACACGAAGCCCACAACAAAAGCCGAGACAAAAG
 
. : . : . : . : . : . :
JMFS148E02+ TCCCGGCAGAGAGTATCGCCCCAAATCCAGTTCTGGGCTGGCCTCCCTTGACGGCAGCTA
JMSF015I12+ CCCGNCAGAGAGTATCGCCCCAAATCCAGTTCTGGGCTGGCCTCCCTTGACGGCAGCTA
JMSF046M06+ GGCCTCCCTTGACGGCAGCTA
                      ____________________________________________________________
consensus TCCCGGCAGAGAGTATCGCCCCAAATCCAGTTCTGGGCTGGCCTCCCTTGACGGCAGCTA
 
. : . : . : . : . : . :
JMFS148E02+ CGGAAGCAAACACATCCGGGGCCCCATTCCCCAGCGCCAAGAGCGTCACCGCACCCATGG
JMSF015I12+ CGGAAGCAAACACATCCGGGGCCCCATTCCCCAGCGCCAAGAGCGTCACCGCACCCATGG
JMSF046M06+ NGGAAGCAAACACATCNGGGGCCCCATTCCCCAGCGCCAAGAGCGTCACCGCACCCATGG
                      ____________________________________________________________
consensus CGGAAGCAAACACATCCGGGGCCCCATTCCCCAGCGCCAAGAGCGTCACCGCACCCATGG
 
. : . : . : . : . : . :
JMFS148E02+ ACGGCGAGAGGCGGAGATGAGCGACGAGCTTGGTGACCACGACGGAGAAGTGGGCCTGGG
JMSF015I12+ ACGGCGAGAGGCGGAGATGAGCGACGAGCTTGGTGACCACGACGGAGAAGTGGGCCTGGG
JMSF046M06+ ACGGCGAGAGGCGGAGATGAGCGACGAGCTNGGTGNCCACGACGGAGAANTGGGCCTGGG
                      ____________________________________________________________
consensus ACGGCGAGAGGCGGAGATGAGCGACGAGCTTGGTGACCACGACGGAGAAGTGGGCCTGGG
 
. : . : . : . : . : . :
JMFS148E02+ CCGTAGTGATGAGGATGTAGAAGTAAAGGAGCACGAAAAGCCCAAGAAACGGGACGGAGA
JMSF015I12+ CCGTAGTGATGAGGATGTAGAAGTAAAGGAGCACGAAAAGCCCAAGAAACGGGACGGAGA
JMSF046M06+ CCGTAGTGATGAGGATGTAGAAGTAAAGGAGCACGAAAAGCCCAAGAAACGGGACGGAGA
                      ____________________________________________________________
consensus CCGTAGTGATGAGGATGTAGAAGTAAAGGAGCACGAAAAGCCCAAGAAACGGGACGGAGA
 
. : . : . : . : . : . :
JMFS148E02+ GAAATGGGTTTTGGCGGAAGAGGCAGGAGTGGATGGAGAAGTAGTTGAAGAGTCCATCGG
JMSF015I12+ GAAATGGGTTTTGGCGGAAGAGGCAGGAGTGGATGGAGAAGTAGTTGAAGAGTCCATCGG
JMSF046M06+ GAAATGGGTTTNGGCGGAAGAGGCANGAGTGGATGGNGAAGTANTTGAAGAGTCCATCGG
                      ____________________________________________________________
consensus GAAATGGGTTTTGGCGGAAGAGGCAGGAGTGGATGGAGAAGTAGTTGAAGAGTCCATCGG
 
. : . : . : . : . : . :
JMFS148E02+ ATTCATCACTACTGAAGAATCTGCAGGAGGGTTGGGGGGAATTGAGGAGAGACCTGTGAG
JMSF015I12+ ATTCATCACTACTGAAGAATCTGCAGGAGGGTTGGGGGGAATTGAGGAGAGACCTGTGAG
JMSF046M06+ ATTCATCANTACTGAAGAATCTGCAGGAGGGTTGGGGNGAATTGAGGAGAGACCTGTGAG
                      ____________________________________________________________
consensus ATTCATCACTACTGAAGAATCTGCAGGAGGGTTGGGGGGAATTGAGGAGAGACCTGTGAG
 
. : . : . : . : . : . :
JMFS148E02+ GAGAGAGTAATATGTGTTTTGATGGATGGTTAGAGGAATATGTAGGCGGCAGGTGGAGGA
JMSF015I12+ GAGAGAGTAATATGTGTTTTGATGGATGGTTAGAGGAATATGTAGGCGGCAGGTGGAGGA
JMSF046M06+ GAGAGAGTAATATGTGTTTTGATGGATGGTTAGAGGAATATNTAGGCGGCAGCTGGAGGA
                      ____________________________________________________________
consensus GAGAGAGTAATATGTGTTTTGATGGATGGTTAGAGGAATATGTAGGCGGCAGGTGGAGGA
 
. : . : . : . : . : . :
JMFS148E02+ GGAAGAAGGCGACGGTGGCAAGGAGGAATAGTGAGATCGCGGTGGTTGTCAGAGCGGCGG
JMSF015I12+ GGAAGAAGGCGACGGTGGCAAGGAGGAATAGTGAGATCGCGGTGGTTGTCAGAGCGGCGG
JMSF046M06+ GGAAGAAGGCGACGGTGGCAAGGAGGAATAGTGAGATCGCGGTGGTTGTCANAGCGGCGG
                      ____________________________________________________________
consensus GGAAGAAGGCGACGGTGGCAAGGAGGAATAGTGAGATCGCGGTGGTTGTCAGAGCGGCGG
 
. : . : . : . : . : . :
JMFS148E02+ AGTTGAAGGCCATGCCATACCAAAAAAAGCTCAAACAA
JMSF015I12+ AGTTGAAGGCCATGCCATACCAAAAAAAGCTCAAACAA
JMSF046M06+ AGTTGANGGCCATGCCATACCAAAAAAAGCTCAAACAATTTACACGCGGGGTCTTCCNCC
                      ____________________________________________________________
consensus AGTTGAAGGCCATGCCATACCAAAAAAAGCTCAAACAATTTACACGCGGGGTCTTCCNCC