Previous Contig 007728:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF036J12Sequence686007728 (2)gb:BT014785_16417751e-36Arabidopsis thaliana At3g26510 gene, complete cds.>gb:BT015013_1641983 Arabidops148013047 (2)
JMSF046I15Sequence743007728 (2)gb:BT014785_16417759e-43Arabidopsis thaliana At3g26510 gene, complete cds.>gb:BT015013_1641983 Arabidops141013047 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046I15+ CACAAGCTTCCATTATTGCCAGT
                      ____________________________________________________________
consensus CACAAGCTTCCATTATTGCCAGT
 
. : . : . : . : . : . :
JMSF036J12+ ATATGGCCAGTGTTTCCAGGACCATGGTGGTAGGCAT
JMSF046I15+ GGTTGCCATGGTGGATCAAATAAATATGGCCAGTGTTTCCAGGACCATGGTGGTAGGCAT
                      ____________________________________________________________
consensus GGTTGCCATGGTGGATCAAATAAATATGGCCAGTGTTTCCAGGACCATGGTGGTAGGCAT
 
. : . : . : . : . : . :
JMSF036J12+ ACTGAGGAAGCTTTGCAGCAGCTTTCTTATGGCAAGGGGGAAACACCATAGGGGGCATTG
JMSF046I15+ ACTGAGGAAGCTTTGCAGCAGCTTTCTTATGGCAAGGGGGAAACACCATAGGGGGCATTG
                      ____________________________________________________________
consensus ACTGAGGAAGCTTTGCAGCAGCTTTCTTATGGCAAGGGGGAAACACCATAGGGGGCATTG
 
. : . : . : . : . : . :
JMSF036J12+ ACATCTGACAGGCACACCTCTTAGTACTAGATGATCCAAAGTACCTCGAAGCAGAGTAGG
JMSF046I15+ ACATCTGACAGGCACACCTCTTAGTACTAGATGATCCAAAGTACCTCGAAGCAGAGTAGG
                      ____________________________________________________________
consensus ACATCTGACAGGCACACCTCTTAGTACTAGATGATCCAAAGTACCTCGAAGCAGAGTAGG
 
. : . : . : . : . : . :
JMSF036J12+ ACTTTGGTGATAAAGCATCATTGGTGGTAGACAAAGAACCAAATGAAGGCGAAGGAGAGG
JMSF046I15+ ACTTTGGTGATAAAGCATCATTGGTGGTAGACAAAGAACCAAATGAAGGCGAAGGAGAGG
                      ____________________________________________________________
consensus ACTTTGGTGATAAAGCATCATTGGTGGTAGACAAAGAACCAAATGAAGGCGAAGGAGAGG
 
. : . : . : . : . : . :
JMSF036J12+ CTCTTTTGTTGGATTTGGGTGGTGAAAGAAAGGCCCTTATCTTGAAAGAGCATGGTGGAG
JMSF046I15+ CTCTTTTGTTGGATTTGGGTGGTGAAAGAAAGGCCCTTATCTTGAAAGAGCATGGTGGAG
                      ____________________________________________________________
consensus CTCTTTTGTTGGATTTGGGTGGTGAAAGAAAGGCCCTTATCTTGAAAGAGCATGGTGGAG
 
. : . : . : . : . : . :
JMSF036J12+ ACTCTAATCGATCATATTCCTCAATAAGATTGATTAGATCCTCATCACAGGTGATTGACA
JMSF046I15+ ACTCTAATCGATCATATTCCTCAATAAGATTGATTAGATCCTCATCACAGGTGATTGACA
                      ____________________________________________________________
consensus ACTCTAATCGATCATATTCCTCAATAAGATTGATTAGATCCTCATCACAGGTGATTGACA
 
. : . : . : . : . : . :
JMSF036J12+ CCAGTGCATCTAAATCTTCAGTTGGCAGTTGACACCTCAGACTAACCCCAGCTCCAAACA
JMSF046I15+ CCAGTGCATCTAAATCTTCAGTTGGCAGTTGACACCTCAGACTAACCCCAGCTCCAAACA
                      ____________________________________________________________
consensus CCAGTGCATCTAAATCTTCAGTTGGCAGTTGACACCTCAGACTAACCCCAGCTCCAAACA
 
. : . : . : . : . : . :
JMSF036J12+ TCTTTCCGAGCTTCGCCAACAGCTCGGCAAAAGAAATGGAGCGCTCGACGGAAAGTACAC
JMSF046I15+ TCTTTCCGAGCTTCGCCAACAGCTCGGCAAAAGAAATGGAGCGCTCGACGGAAAGTACAC
                      ____________________________________________________________
consensus TCTTTCCGAGCTTCGCCAACAGCTCGGCAAAAGAAATGGAGCGCTCGACGGAAAGTACAC
 
. : . : . : . : . : . :
JMSF036J12+ GGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGATGGCGAGGGAGAATCTTTCCGC
JMSF046I15+ GGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGATGGCGAGGGAGAATCTTTCCGC
                      ____________________________________________________________
consensus GGGTCTCGCCGCCATAGTAACGGAGCTTGCCGTCAGGATGGCGAGGGAGAATCTTTCCGC
 
. : . : . : . : . : . :
JMSF036J12+ CATAGCTACAGAGGAATTTGATG
JMSF046I15+ CATAGCTACAGAGGAATTTGATGTTGGTGGGAGAAGGACCGACCATCGTTTACAGATTTT
                      ____________________________________________________________
consensus CATAGCTACAGAGGAATTTGATGTTGGTGGGAGAAGGACCGACCATCGTTTACAGATTTT
 
. : . : . : . : . : . :
JMSF046I15+ TTTGTAGAAACTGATCCGATTTCTAGAAGACACAAAAGAGAACTCAGAAAGAAGAATTTG
                      ____________________________________________________________
consensus TTTGTAGAAACTGATCCGATTTCTAGAAGACACAAAAGAGAACTCAGAAAGAAGAATTTG
 
. : . : . : . : . : . :
JMSF046I15+ AAGAAGAAAAAGGCTCTGAAGTCTGAATATGCTTTTTCTTCAGTGGCTTCTTCAAGCGTC
                      ____________________________________________________________
consensus AAGAAGAAAAAGGCTCTGAAGTCTGAATATGCTTTTTCTTCAGTGGCTTCTTCAAGCGTC