Previous Contig 007726:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029I04Sequence649007726 (3)gb:AE016959_10228991e-53Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01728012652 (3)gb:AE016959_10228992e-42Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01
JMSF029J04Sequence663007726 (3)gb:AE016959_10228991e-54Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01735012652 (3)gb:AE016959_10228993e-44Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01
JMSF046I07Sequence744007726 (3)gb:AE016959_10228995e-62Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01789012652 (3)pir|T00588|T005886e-46hypothetical protein At2g30100 [imported] - Arabidopsis thaliana>gb:AC004165_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046I07+ TGCAATATGAAGCTGCTGCAGGCT
                      ____________________________________________________________
consensus TGCAATATGAAGCTGCTGCAGGCT
 
. : . : . : . : . : . :
JMSF029J04+ AAGAAT
JMSF046I07+ TCTCAATGCACCGAGGTTGGAAGGTATAATTGTTAATTGGTTCTCGTTCAAAGAAAGAAT
                      ____________________________________________________________
consensus TCTCAATGCACCGAGGTTGGAAGGTATAATTGTTAATTGGTTCTCGTTCAAAGAAAGAAT
 
. : . : . : . : . : . :
JMSF029J04+ TTCCAAATGTTTCAGAGACGCTATCCCTTCCCAGCTAAGAGATTTATCCTCAATGCCATT
JMSF029I04+ GTTTCAGAGACGCTATCCCTTCCCAGCTAAGAGATTTATCCTCAATGCCATT
JMSF046I07+ TTCCAAATGTTTCAGAGACGCTATCCCTTCCCAGCTAAGAGATTTATCCTCAATGCCATT
                      ____________________________________________________________
consensus TTCCAAATGTTTCAGAGACGCTATCCCTTCCCAGCTAAGAGATTTATCCTCAATGCCATT
 
. : . : . : . : . : . :
JMSF029J04+ CGCATTAAGGAACAGTTTCGTAAGAGAATCCAAACGACTAATTTTAGCCGGAACATCTTT
JMSF029I04+ CGCATTAAGGAACAGTTTCGTAAGAGAATCCAAACGACTAATTTTAGCCGGAACATCTTT
JMSF046I07+ CGCATTAAGGAACAGTTTCGTAAGAGAATCCAAACGACTAATTTTAGCCGGAACATCTTT
                      ____________________________________________________________
consensus CGCATTAAGGAACAGTTTCGTAAGAGAATCCAAACGACTAATTTTAGCCGGAACATCTTT
 
. : . : . : . : . : . :
JMSF029J04+ CACTGAGTTGTTATTCAAATCAAGAAGTCTAGCATAATGTCCACAGTTCCATATTTCATC
JMSF029I04+ CACTGAGTTGTTATTCAAATCAAGAAGTCTAGCATAATGTCCACAGTTCCATATTTCATC
JMSF046I07+ CACTGAGTTGTTATTCAAATCAAGAAGTCTAGCATAATGTCCACAGTTCCATATTTCATC
                      ____________________________________________________________
consensus CACTGAGTTGTTATTCAAATCAAGAAGTCTAGCATAATGTCCACAGTTCCATATTTCATC
 
. : . : . : . : . : . :
JMSF029J04+ AGGAATGGCCTTCAGACCGCTATCAGATAATCCTAATACCCCAGTAACCTGCCACCGTCG
JMSF029I04+ AGGAATGGCCTTCAGACCGCTATCAGATAATCCTAATACCCCAGTAACCTGCCACCGTCG
JMSF046I07+ AGGAATGGCCTTCAGACCGCTATCAGATAATCCTAATACCCCAGTAACCTGCCACCGTCG
                      ____________________________________________________________
consensus AGGAATGGCCTTCAGACCGCTATCAGATAATCCTAATACCCCAGTAACCTGCCACCGTCG
 
. : . : . : . : . : . :
JMSF029J04+ TTCATGGTCACTCCTTTTAACATAAACCTGAGACTTTTCCATTTTTGGCCTATGAGATTC
JMSF029I04+ TTCATGGTCACTCCTTTTAACATAAACCTGAGACTTTTCCATTTTTGGCCTATGAGATTC
JMSF046I07+ TTCATGGTCACTCCTTTTAACATAAACCTGAGACTTTTCCATTTTTGGCCTATGAGATTC
                      ____________________________________________________________
consensus TTCATGGTCACTCCTTTTAACATAAACCTGAGACTTTTCCATTTTTGGCCTATGAGATTC
 
. : . : . : . : . : . :
JMSF029J04+ ATGTGGCCTTCTCACAGTTGACAATGGTGAAGCTTCTTTTGTAATTGGCCCATCCCCTTG
JMSF029I04+ ATGTGGCCTTCTCACAGTTGACAATGGTGAAGCTTCTTTTGTAATTGGCCCATCCCCTTG
JMSF046I07+ ATGTGGCCTTCTCACAGTTGACAATGGTGAAGCTTCTTTTGTAATTGGCCCATCCCCTTG
                      ____________________________________________________________
consensus ATGTGGCCTTCTCACAGTTGACAATGGTGAAGCTTCTTTTGTAATTGGCCCATCCCCTTG
 
. : . : . : . : . : . :
JMSF029J04+ GTGTAGACCTTGGGAGCCCATGAGCATGATTTTGGAGCCATTAACAATGCCCGAGGACCT
JMSF029I04+ GTGTAGACCTTGGGAGCCCATGAGCATGATTTTGGAGCCATTAACAATGCCCGAGGACCT
JMSF046I07+ GTGTAGACCTTGGGAGCCCATGAGCATGATTTTGGAGCCATTAACAATGCCCGAGGACCT
                      ____________________________________________________________
consensus GTGTAGACCTTGGGAGCCCATGAGCATGATTTTGGAGCCATTAACAATGCCCGAGGACCT
 
. : . : . : . : . : . :
JMSF029J04+ CAGTGTCATTTCATCACCAATAACTTTCCCTTTAGAGATGATTTTTTGGCCGCGAGGGAG
JMSF029I04+ CAGTGTCATTTCATCACCAATAACTTTCCCTTTAGAGATGATTTTTTGGCCGCGAGGGAG
JMSF046I07+ CAGTGTCATTTCATCACCAATAACTTTCCCTTTAGAGATGATTTTTTGGCCGCGAGGGAG
                      ____________________________________________________________
consensus CAGTGTCATTTCATCACCAATAACTTTCCCTTTAGAGATGATTTTTTGGCCGCGAGGGAG
 
. : . : . : . : . : . :
JMSF029J04+ GACATTGGTGAGCGGCTGGAGTAGAGACTTAAGTTCGTTGACCGTCGCGTCGGCGGAGAC
JMSF029I04+ GACATTGGTGAGCGGCTGGAGTAGAGACTTAAGTTCGTTGACCGTCGCGTCGGCGGAGAC
JMSF046I07+ GACATTGGTGAGCGGCTGGAGTAGAGACTTAAGTTCGTTGACCGTCGCGTCGGCGGAGAC
                      ____________________________________________________________
consensus GACATTGGTGAGCGGCTGGAGTAGAGACTTAAGTTCGTTGACCGTCGCGTCGGCGGAGAC
 
. : . : . : . : . : . :
JMSF029J04+ TTCCACCGGAATATTCCTTCCGGCGAATTTCACATTCACAATAATCGCAGACGGCTTCTG
JMSF029I04+ TTCCACCGGAATATTCCTTCCGGCGAATTTCACATTCACAATAATCGCAGACGGCTTCTG
JMSF046I07+ TTCAACCGGAATATTCCTTCCGGCGAATTTCACATTCACAATAATCGCAGACGGCTTCTG
                      ____________________________________________________________
consensus TTCCACCGGAATATTCCTTCCGGCGAATTTCACATTCACAATAATCGCAGACGGCTTCTG
 
. : . : . : . : . : . :
JMSF029J04+ AGGATTGCTGCCTCTTCCTTCCTCCATTTTCGCCTATCTGCTTACTTCTCCACGAC
JMSF029I04+ AGGATTGCTGCCTCTTCCTTCCTCCATTTTCGCCTATCTGCTTACTTCTCCACGAC
JMSF046I07+ AGGATTGCTGCCTCTTCCTTCCTCCATTTTCGCCTATCTGCTTACTTCTCCACGACAGTC
                      ____________________________________________________________
consensus AGGATTGCTGCCTCTTCCTTCCTCCATTTTCGCCTATCTGCTTACTTCTCCACGACAGTC