Previous Contig 007725:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008L12Sequence134007725 (2)733013659 (2)gb:BT006445_16393321e-86Arabidopsis thaliana At4g21120 gene, complete cds.
JMSF046I05Sequence758007725 (2)gb:BT006445_16393321e-68Arabidopsis thaliana At4g21120 gene, complete cds.842013659 (2)gb:BT006445_16393328e-81Arabidopsis thaliana At4g21120 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046I05+ TGATGAGAAAAGAATCGGGATGCTGGTTGCAGAGAGTG
                      ____________________________________________________________
consensus TGATGAGAAAAGAATCGGGATGCTGGTTGCAGAGAGTG
 
. : . : . : . : . : . :
JMSF046I05+ GCCAAGTAAGATGTCCAGGANCGAGCCACTGCCGCTCCGCCGATCACATATTCCAGAAGG
                      ____________________________________________________________
consensus GCCAAGTAAGATGTCCAGGANCGAGCCACTGCCGCTCCGCCGATCACATATTCCAGAAGG
 
. : . : . : . : . : . :
JMSF046I05+ ATGTTTCCGGCGGCTATGAAGGCCACAAAGTCACCTAACTCTACCCTTAGATACGCAAAT
                      ____________________________________________________________
consensus ATGTTTCCGGCGGCTATGAAGGCCACAAAGTCACCTAACTCTACCCTTAGATACGCAAAT
 
. : . : . : . : . : . :
JMSF046I05+ GAACCACCNGCAACAGGGATCTCGANGGNGAACTCAGTATAGCAGAAGACAGAGAGCAAA
                      ____________________________________________________________
consensus GAACCACCNGCAACAGGGATCTCGANGGNGAACTCAGTATAGCAGAAGACAGAGAGCAAA
 
. : . : . : . : . : . :
JMSF046I05+ GCAGAGATACCGGAGANGACGTAAGAGAGGACAACGGNGGGTCCAGCATCATCNCGCGCN
                      ____________________________________________________________
consensus GCAGAGATACCGGAGANGACGTAAGAGAGGACAACGGNGGGTCCAGCATCATCNCGCGCN
 
. : . : . : . : . : . :
JMSF046I05+ TCCAGTCCGGTGAGAAAGAATATTCNGGCGCCGATCACGGCCCCCANGCCGAACCATATC
                      ____________________________________________________________
consensus TCCAGTCCGGTGAGAAAGAATATTCNGGCGCCGATCACGGCCCCCANGCCGAACCATATC
 
. : . : . : . : . : . :
JMSF046I05+ AGATCCCACCATGTGAGANTCTTNTTCATGTCGTGGNTGCTCCGGGACTTGGCGGCCAGN
                      ____________________________________________________________
consensus AGATCCCACCATGTGAGANTCTTNTTCATGTCGTGGNTGCTCCGGGACTTGGCGGCCAGN
 
. : . : . : . : . : . :
JMSF046I05+ TCCGCCTTGTNGTNGGAGCGGCTCAAAACCCGATCCACCAGCCGCGANGGAGTNTGTTTC
                      ____________________________________________________________
consensus TCCGCCTTGTNGTNGGAGCGGCTCAAAACCCGATCCACCAGCCGCGANGGAGTNTGTTTC
 
. : . : . : . : . : . :
JMSF046I05+ AGCGCATTCACGTAGTTGCCCCAGCTCNTGAANGATTCCTCGGGGAGAAAATNGTCCTTT
                      ____________________________________________________________
consensus AGCGCATTCACGTAGTTGCCCCAGCTCNTGAANGATTCCTCGGGGAGAAAATNGTCCTTT
 
. : . : . : . : . : . :
JMSF008L12+ TGATTCTCCATTTTCT
JMSF046I05+ GTGCATGAACAAAACCGAGATNTCCTCCTCACTCNTGATGATTCTGATTCTCCATTTTCT
                      ____________________________________________________________
consensus GTGCATGAACAAAACCGAGATNTCCTCCTCACTCNTGATGATTCTGATTCTCCATTTTCT
 
. : . : . : . : . : . :
JMSF008L12+ CCCCCCATTTTTCTCACCATTTTACTAACTGCCAAATGAACACTCGATATGATCGATCCT
JMSF046I05+ CCCCCCATTTTTCTCACCATTTTACTAACTGCCAAATGAACACTCGATATGATCGATCCT
                      ____________________________________________________________
consensus CCCCCCATTTTTCTCACCATTTTACTAACTGCCAAATGAACACTCGATATGATCGATCCT
 
. : . : . : . : . : . :
JMSF008L12+ CTCTCTCTCTCTCTCTCTCTCTCTCTCTATGTGTGTGTGTTTATCAGAATCAGAAAC
JMSF046I05+ CTCTCTCTCTCTCTCTCTCTCTCTCTCTATGTGTGTGTGTTTATCAGAATCAGAAACGAA
                      ____________________________________________________________
consensus CTCTCTCTCTCTCTCTCTCTCTCTCTCTATGTGTGTGTGTTTATCAGAATCAGAAACGAA
 
. : . : . : . : . : . :
JMSF046I05+ GATACAAGTTTCTCTCCAGAAAGTATAAGAACGACTCACGTATGGAGACCAGAAGAGCTC
                      ____________________________________________________________
consensus GATACAAGTTTCTCTCCAGAAAGTATAAGAACGACTCACGTATGGAGACCAGAAGAGCTC