Previous Contig 007724:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004D17Sequence583007724 (2)gb:BT006445_16393323e-77Arabidopsis thaliana At4g21120 gene, complete cds.721013655 (2)gb:BT006445_16393324e-47Arabidopsis thaliana At4g21120 gene, complete cds.
JMSF046G23Sequence670007724 (2)gb:BT006445_16393325e-79Arabidopsis thaliana At4g21120 gene, complete cds.702013655 (2)gb:BT006445_16393323e-39Arabidopsis thaliana At4g21120 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004D17+ CGATGATGAACACA
                      ____________________________________________________________
consensus CGATGATGAACACA
 
. : . : . : . : . : . :
JMFF004D17+ ATCACAACCATGTGAACGATGGAGGCGATGTAGTTGAGACGTGAAGAGCCCTTTGTGCTG
                      ____________________________________________________________
consensus ATCACAACCATGTGAACGATGGAGGCGATGTAGTTGAGACGTGAAGAGCCCTTTGTGCTG
 
. : . : . : . : . : . :
JMFF004D17+ AGGATTGCGATGATGCAAATGGCGAAACAGACTCCCACGGCGATTGGGTNTAAGAGATTA
JMSF046G23+ TAAGAGATTA
                      ____________________________________________________________
consensus AGGATTGCGATGATGCAAATGGCGAAACAGACTCCCACGGCGATTGGGTNTAAGAGATTA
 
. : . : . : . : . : . :
JMFF004D17+ TAGCCTTCGTGCAGGGCATTAGCCTTGATGAGAAAACTCTCGGGGTGTTTGTTGAAAAGA
JMSF046G23+ TAGCCTTCGTGCAGGGCATTAGCCTTGATGAGAAAACCCTCGGGGTGTTTGTTGAAAAGA
                      ____________________________________________________________
consensus TAGCCTTCGTGCAGGGCATTAGCCTTGATGAGAAAACTCTCGGGGTGTTTGTTGAAAAGA
 
. : . : . : . : . : . :
JMFF004D17+ GTGGCCAAGTAGTAAGTCCATGAACGAGCAACTGCGGCTCCGCCGATCACGTACTCAAGA
JMSF046G23+ GTGGCCAAGTAGTAAGTCCATGAACGAGCAACTGCGGCTCCGCCGATCACGTACTCAAGA
                      ____________________________________________________________
consensus GTGGCCAAGTAGTAAGTCCATGAACGAGCAACTGCGGCTCCGCCGATCACGTACTCAAGA
 
. : . : . : . : . : . :
JMFF004D17+ AGTATGTTTCCGGCAGCGATGAAGGCCACAAAGTCGCCAAGTTCAACCCTTAGATAGGCA
JMSF046G23+ AGTATGTTTCCGGCAGCGATGAAGGCCACAAAGTCGCCAAGTTCAACCCTTAGATAGGCA
                      ____________________________________________________________
consensus AGTATGTTTCCGGCAGCGATGAAGGCCACAAAGTCGCCAAGTTCAACCCTTAGATAGGCA
 
. : . : . : . : . : . :
JMFF004D17+ AATGAACCACCTGCAACTGGTATCTCGACGGCGAACTCAGTGTAGCAGAAGACAGAAAGC
JMSF046G23+ AATGAACCACCTGCAACTGGTATCTCGACGGCGAACTCAGTGTAGCAGAAGACAGAAAGC
                      ____________________________________________________________
consensus AATGAACCACCTGCAACTGGTATCTCGACGGCGAACTCAGTGTAGCAGAAGACAGAAAGC
 
. : . : . : . : . : . :
JMFF004D17+ ATGGCGGAGAGGCCGGAGACGGTGTAGGAGAGGACGACAGCAGGGCCGGCGTGTTGGTTG
JMSF046G23+ ATGGCGGAGAGGCCGGAGACGGTGTAGGAGAGGACGACAGCAGGGCCGGCGTGTTGGTTG
                      ____________________________________________________________
consensus ATGGCGGAGAGGCCGGAGACGGTGTAGGAGAGGACGACAGCAGGGCCGGCGTGTTGGTTG
 
. : . : . : . : . : . :
JMFF004D17+ GCCTCCTGGCCGGTGAGGACGAAAATTCCGGCGCCGATGACGGCGCCCATGCCAAACCAA
JMSF046G23+ GCCTCCTGGCCGGTGAGGACGAAAATTCCGGCGCCGATGACGGCGCCCATGCCAAACCAA
                      ____________________________________________________________
consensus GCCTCCTGGCCGGTGAGGACGAAAATTCCGGCGCCGATGACGGCGCCCATGCCAAACCAA
 
. : . : . : . : . : . :
JMFF004D17+ ATAAGATCCCACCAGTTAAGGTTCCTCTTCATCTCGTGTTGGCTGCGCGACTTGGCGGCG
JMSF046G23+ ATAAGATCCCACCAGTTAAGGTTCCTCTTCATCTCGTGTTGGCTGCGCGACTTGGCGGCG
                      ____________________________________________________________
consensus ATAAGATCCCACCAGTTAAGGTTCCTCTTCATCTCGTGTTGGCTGCGCGACTTGGCGGCG
 
. : . : . : . : . : . :
JMFF004D17+ AGCTCCACCTGGTCCAAGGAGCGGCTGAA
JMSF046G23+ AGCTCCACCTGGTCCAAGGAGCGGCTGAACACCCGATCCCTCAGCCGCGCCGGAGTCTGC
                      ____________________________________________________________
consensus AGCTCCACCTGGTCCAAGGAGCGGCTGAACACCCGATCCCTCAGCCGCGCCGGAGTCTGC
 
. : . : . : . : . : . :
JMSF046G23+ CTCAGCGCATTGACGTAGTTGCCCCAGCTCCTGAACGATTCCTCAGGGAGAAAATCGTCC
                      ____________________________________________________________
consensus CTCAGCGCATTGACGTAGTTGCCCCAGCTCCTGAACGATTCCTCAGGGAGAAAATCGTCC
 
. : . : . : . : . : . :
JMSF046G23+ TTACCGCAGGAACACCCTCTTATCCTCATCCCTGATTCTGAACCGCCATTTTTAGTTTCA
                      ____________________________________________________________
consensus TTACCGCAGGAACACCCTCTTATCCTCATCCCTGATTCTGAACCGCCATTTTTAGTTTCA
 
. : . : . : . : . : . :
JMSF046G23+ ACCTCCATTTTAATTTCTATCGATCGGCTTGGTGAACTGCAAAAGCAAAGTTGCTATATC
                      ____________________________________________________________
consensus ACCTCCATTTTAATTTCTATCGATCGGCTTGGTGAACTGCAAAAGCAAAGTTGCTATATC