Previous Contig 007713:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN017G04Sequence613007713 (2)gb:AB119250_15279145e-75Nicotiana tabacum mRNA for prolyl 4-hydroxylase, complete cds.
JMSF046E07Sequence782007713 (2)gb:AB119250_15279141e-66Nicotiana tabacum mRNA for prolyl 4-hydroxylase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN017G04+ AAAAAAATT
                      ____________________________________________________________
consensus AAAAAAATT
 
. : . : . : . : . : . :
JMFN017G04+ GAACTATTTCCTCATTATGATACAGGGAATATCTTTCACAAATGGTGACAAAAAAGAACT
                      ____________________________________________________________
consensus GAACTATTTCCTCATTATGATACAGGGAATATCTTTCACAAATGGTGACAAAAAAGAACT
 
. : . : . : . : . : . :
JMFN017G04+ AAATAATATATTCACTAGGCAACATTGTTATTGGCAGAATTGTGGGGGGGGGGGGGGGGG
                      ____________________________________________________________
consensus AAATAATATATTCACTAGGCAACATTGTTATTGGCAGAATTGTGGGGGGGGGGGGGGGGG
 
. : . : . : . : . : . :
JMFN017G04+ GTGGCATTTAGTCATCTTGTTCTTGATCCCTGATCCACTTTGTTGCCACCCATTTTTGTC
                      ____________________________________________________________
consensus GTGGCATTTAGTCATCTTGTTCTTGATCCCTGATCCACTTTGTTGCCACCCATTTTTGTC
 
. : . : . : . : . : . :
JMFN017G04+ CTTTGATCACTGGACAGCTCCCATGAAGCGAGGTTGGATCGATTGTGCCATTTAGAAGAA
                      ____________________________________________________________
consensus CTTTGATCACTGGACAGCTCCCATGAAGCGAGGTTGGATCGATTGTGCCATTTAGAAGAA
 
. : . : . : . : . : . :
JMFN017G04+ GCGAGTAGAATAGAAGTCCATCCCCTTTGCGGGGCTTTACTTTTAAACCTTCACACCTGC
JMSF046E07+ GC
                      ____________________________________________________________
consensus GCGAGTAGAATAGAAGTCCATCCCCTTTGCGGGGCTTTACTTTTAAACCTTCACACCTGC
 
. : . : . : . : . : . :
JMFN017G04+ GGAAGTCATAATTACCATCCATGTTCTGTCCATACTCAAAAGGGAACATGGTTTCCCCAC
JMSF046E07+ GGAAGTCATAATTACCATCCATGTTCTGTCCATACTCAAAAGGGAACATGGTTTCCCCAC
                      ____________________________________________________________
consensus GGAAGTCATAATTACCATCCATGTTCTGTCCATACTCAAAAGGGAACATGGTTTCCCCAC
 
. : . : . : . : . : . :
JMFN017G04+ CTTCTTCAACATCTGAAAGGTATAACAAGAATGAAGCAACCCTTTGGCTCTTCTGTGGGC
JMSF046E07+ CTTCTTCAACATCTGAAAGGTATAACAAGAATGAAGCAACCCTTTGGCTCTTCTGTGGGC
                      ____________________________________________________________
consensus CTTCTTCAACATCTGAAAGGTATAACAAGAATGAAGCAACCCTTTGGCTCTTCTGTGGGC
 
. : . : . : . : . : . :
JMFN017G04+ CATATTCAGCGGGATTGAATGCGTCATAATGAGAATGATAGCTTTGGCCAATTTCATAGC
JMSF046E07+ CATATTCAGCGGGATTGAATGCGTCATAATGAGAATGATAGCTTTGGCCAATTTCATAGC
                      ____________________________________________________________
consensus CATATTCAGCGGGATTGAATGCGTCATAATGAGAATGATAGCTTTGGCCAATTTCATAGC
 
. : . : . : . : . : . :
JMFN017G04+ GCAAAACATTAAATGCCTCTCCATGGGACCTGGGAATCATTGTCACCTTAGCAATTTTCT
JMSF046E07+ GCAAAACATTAAATGCCTCTCCATGGGACCTGGGAATCATTGTCACCTTAGCAATTTTCT
                      ____________________________________________________________
consensus GCAAAACATTAAATGCCTCTCCATGGGACCTGGGAATCATTGTCACCTTAGCAATTTTCT
 
. : . : . : . : . : . :
JMFN017G04+ CCTCAATGAGATCCAAAGTTCCTGTTTTGTCTTCTGATGCACTTATAAATGTGCCAGAAC
JMSF046E07+ CCTCAATGAGATCCAAAGTTCCTGTTTTGTCTTCTGATGCACTTATAAATGTGCCAGAAC
                      ____________________________________________________________
consensus CCTCAATGAGATCCAAAGTTCCTGTTTTGTCTTCTGATGCACTTATAAATGTGCCAGAAC
 
. : . : . : . : . : . :
JMFN017G04+ TTGT
JMSF046E07+ TTGTTCTTATTCCCTTTGTGTTTTCTGCCGTTTCTCCTTTACGAAGAGCTAAAGATGAAG
                      ____________________________________________________________
consensus TTGTTCTTATTCCCTTTGTGTTTTCTGCCGTTTCTCCTTTACGAAGAGCTAAAGATGAAG
 
. : . : . : . : . : . :
JMSF046E07+ GTTTGAGTTGTTTTTTTGCCATTTTGACAATGCTTTCACATTGCTCTGAAAGGGGATGAG
                      ____________________________________________________________
consensus GTTTGAGTTGTTTTTTTGCCATTTTGACAATGCTTTCACATTGCTCTGAAAGGGGATGAG
 
. : . : . : . : . : . :
JMSF046E07+ AGACATTGAATCCTCTCCCGTCTCGCCGTGCGGCAGCGGATCAAAATCTCGCCACGTATC
                      ____________________________________________________________
consensus AGACATTGAATCCTCTCCCGTCTCGCCGTGCGGCAGCGGATCAAAATCTCGCCACGTATC
 
. : . : . : . : . : . :
JMSF046E07+ CACCGACTCCAGCATCCTAGACCTCGCCCGCATAAATCCTTCATCCTGCTGAGAGAAGAG
                      ____________________________________________________________
consensus CACCGACTCCAGCATCCTAGACCTCGCCCGCATAAATCCTTCATCCTGCTGAGAGAAGAG
 
. : . : . : . : . : . :
JMSF046E07+ GGAGGAGCCGAAGAAACCGGCGAGGAAGAAGCAGAGGCATAAGAGAAAAACGAACGGCAA
                      ____________________________________________________________
consensus GGAGGAGCCGAAGAAACCGGCGAGGAAGAAGCAGAGGCATAAGAGAAAAACGAACGGCAA
 
. : . : . : . : . : . :
JMSF046E07+ CCCTAGGGTCCTCCATCCACCTCCGACCAATTTGCCTCTGTTGCTCGTCTTCATCAATGA
                      ____________________________________________________________
consensus CCCTAGGGTCCTCCATCCACCTCCGACCAATTTGCCTCTGTTGCTCGTCTTCATCAATGA
 
. : . : . : . : . : . :
JMSF046E07+ ATCTTCCCCTCTGAACTCAACGCCAGCAATTAACGAATTCCGAGTTTGGTTATGAAATTA
                      ____________________________________________________________
consensus ATCTTCCCCTCTGAACTCAACGCCAGCAATTAACGAATTCCGAGTTTGGTTATGAAATTA
 
. : . : . : . : . : . :
JMSF046E07+ TGGATCTGTAATAAGCAATGAGCTATGAAGAAGAAGGGAGCGGAGAGTGTAAAGACGCCC
                      ____________________________________________________________
consensus TGGATCTGTAATAAGCAATGAGCTATGAAGAAGAAGGGAGCGGAGAGTGTAAAGACGCCC