Previous Contig 007712:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS169H08Sequence574007712 (2)pir|D71411|D714111e-27hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV40_1545285 Arabidopsis tha
JMSF046D12Sequence614007712 (2)gb:AP004670_18430532e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P049666024201

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046D12+ CTTCGTGGGGCCCT
                      ____________________________________________________________
consensus CTTCGTGGGGCCCT
 
. : . : . : . : . : . :
JMFS169H08+ ACCACCAGTTCGCCGTCGCTAAACGCCGCGCTGGCCATCCCGGGGAGA
JMSF046D12+ TTAGGCACGGTGACCACCAGTTCGCCGTCGCTAAACGCCGCGCTGGCCATCCCGGGGAGA
                      ____________________________________________________________
consensus TTAGGCACGGTGACCACCAGTTCGCCGTCGCTAAACGCCGCGCTGGCCATCCCGGGGAGA
 
. : . : . : . : . : . :
JMFS169H08+ GTCGACGCCGGGAGCCGAAACCGCCACAGGTCGAGCTCCAGCTCAGTAAGAGGCGAGTCA
JMSF046D12+ GTCGACGCCGGGAGCCGAAACCGCCACAGGTCGAGCTCCAGCTCAGTAAGAGGCGAGTCA
                      ____________________________________________________________
consensus GTCGACGCCGGGAGCCGAAACCGCCACAGGTCGAGCTCCAGCTCAGTAAGAGGCGAGTCA
 
. : . : . : . : . : . :
JMFS169H08+ ACTAGGCCGTCCCCTCGGATAACAATCTTAGTAACACCCGGGTAGATCTGGATGGTGTGG
JMSF046D12+ ACTAGGCCGTCCCCTCGGATAACAATCTTAGTAACACCCGGGTAGATCTGGATGGTGTGG
                      ____________________________________________________________
consensus ACTAGGCCGTCCCCTCGGATAACAATCTTAGTAACACCCGGGTAGATCTGGATGGTGTGG
 
. : . : . : . : . : . :
JMFS169H08+ GCCCTGATATTATCCCCGCTAACGTCGTCGGTCGGGACGATGAAGCGGAAGAAATCGTGG
JMSF046D12+ GCCCTGATATTATCCCCGCTAACGTCGTCGGTCGGGACGATGAAGCGGAAGAAATCGTGG
                      ____________________________________________________________
consensus GCCCTGATATTATCCCCGCTAACGTCGTCGGTCGGGACGATGAAGCGGAAGAAATCGTGG
 
. : . : . : . : . : . :
JMFS169H08+ GTCTCTTCAATCAAAACATCGGCGTCGGAGCGGAAAGGGAGCTCCAGTACCTTGGCAAAG
JMSF046D12+ GTCTCTTCAATCAAAACATCGGCGTCGGAGCGGAAAGGGAGCTCCAGTACCTTGGCAAAG
                      ____________________________________________________________
consensus GTCTCTTCAATCAAAACATCGGCGTCGGAGCGGAAAGGGAGCTCCAGTACCTTGGCAAAG
 
. : . : . : . : . : . :
JMFS169H08+ ATGTGGGGCAGTCGCCGGAGCTTCTTCTGTCGGCAAGCCACGGCGGCGCCGGCCTGAGAA
JMSF046D12+ ATGTGGGGCAGTCGCCGGAGCTTCTTCTGTCGGCAAGCCACGGCGGCGCCGGCCTGAGAA
                      ____________________________________________________________
consensus ATGTGGGGCAGTCGCCGGAGCTTCTTCTGTCGGCAAGCCACGGCGGCGCCGGCCTGAGAA
 
. : . : . : . : . : . :
JMFS169H08+ AGCGCCGACGCGATGTCGTATCTGACCGTGATGTTTCGTTTCTTGGGCACCGGGTGAACC
JMSF046D12+ AGCGCCGACGCGATGTCGTATCTGACCGTGATGTTTCGTTTCTTGGGCACCGGGTGAACC
                      ____________________________________________________________
consensus AGCGCCGACGCGATGTCGTATCTGACCGTGATGTTTCGTTTCTTGGGCACCGGGTGAACC
 
. : . : . : . : . : . :
JMFS169H08+ TTCATGGCTTTAGAACCTGCAAACTCTGGGGTGAATTCAGAGGAAAAGATTACAACTTCC
JMSF046D12+ TTCATGGCTTTAGAACCTGCAAACTCTGGGGTGAATTCAGAGGAAAAGATTCCAACTTCC
                      ____________________________________________________________
consensus TTCATGGCTTTAGAACCTGCAAACTCTGGGGTGAATTCAGAGGAAAAGATTCCAACTTCC
 
. : . : . : . : . : . :
JMFS169H08+ GATAAGAAACGGGTGATTTCAAGAAACAGAGAGAGGAACGCAGAACCCAAACCCTAAAAC
JMSF046D12+ GATAAGAAACGGGTGATTTCAAGAAACAGAGAGAGGAACGCAGAACCCAAACCCTAAAAC
                      ____________________________________________________________
consensus GATAAGAAACGGGTGATTTCAAGAAACAGAGAGAGGAACGCAGAACCCAAACCCTAAAAC
 
. : . : . : . : . : . :
JMFS169H08+ GAAACAAAAATTTTATCAGATATGCAGTTTACTGAGTAGAAATTGA
JMSF046D12+ GAAACAAAAATTTTATCAGATATGCAGTTTACTGAGTAGAAATTGAGTTCTGGGCATATC
                      ____________________________________________________________
consensus GAAACAAAAATTTTATCAGATATGCAGTTTACTGAGTAGAAATTGAGTTCTGGGCATATC