Previous Contig 007703:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034N19Sequence493007703 (3)gb:AY245885_15925701e-34Brassica napus NAC-domain protein 18 (NAC18) mRNA, complete cds.638009838 (2)gb:AF509866_18070705e-30Petunia x hybrida nam-like protein 3 (NH3) mRNA, complete cds.
JMSF007B15Sequence285007703 (3)gb:AY245885_15925705e-14Brassica napus NAC-domain protein 18 (NAC18) mRNA, complete cds.800009838 (2)gb:AF509866_18070702e-71Petunia x hybrida nam-like protein 3 (NH3) mRNA, complete cds.
JMSF046B09Sequence763007703 (3)gb:AY498713_16093883e-50Lycopersicon esculentum NAC domain protein mRNA, complete cds.645024194gb:AY498713_16093884e-27Lycopersicon esculentum NAC domain protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF034N19+ GCAGACCTGTT
                      ____________________________________________________________
consensus GCAGACCTGTT
 
. : . : . : . : . : . :
JMFF034N19+ CGGCCTCGAACCGTTGGGGTACTTTCGGTCCCTCGGAGAAAAGAAGTACCATTCTTTTTC
                      ____________________________________________________________
consensus CGGCCTCGAACCGTTGGGGTACTTTCGGTCCCTCGGAGAAAAGAAGTACCATTCTTTTTC
 
. : . : . : . : . : . :
JMFF034N19+ TCCGTACAAAGCCATATCTGCATCGAGAAATCAATACAAAATTAAAAATCCGATCCCAAA
                      ____________________________________________________________
consensus TCCGTACAAAGCCATATCTGCATCGAGAAATCAATACAAAATTAAAAATCCGATCCCAAA
 
. : . : . : . : . : . :
JMFF034N19+ ACAAATTAAAATTAAAAAGCAGAAGCACTCAACACTAGCGTACGTACCAGGGAGCTGCCA
JMSF046B09+ AGCTGCCA
                      ____________________________________________________________
consensus ACAAATTAAAATTAAAAAGCAGAAGCACTCAACACTAGCGTACGTACCAGGGAGCTGCCA
 
. : . : . : . : . : . :
JMSF007B15+ TCGGCAATAATCGGAACGGAGATAGATTGGGAGGC
JMFF034N19+ GGGGTCAAACTTGTAAAGATCGATCTCGGCAATAATCGGAACGGAGATAGATTGGGAGGC
JMSF046B09+ GGGGTCGAACTTGTAGAGATCAATATCGGCGATAATGGGAACGGAGATAGACTGGGCGGC
                      ____________________________________________________________
consensus GGGGTCGAACTTGTAGAGATCGATCTCGGCAATAATCGGAACGGAGATAGATTGGGAGGC
 
. : . : . : . : . : . :
JMSF007B15+ GCATTTCCGGCAGAGATAGTGAACCACGAGTTCCTCATCCGTCGGATGGAACCGGAA
JMFF034N19+ GCATTTCCGGCAGAGATAGTGAACCACGAGTTCCTCATCCGTCGGATGGAACCGGAA
JMSF046B09+ GCATTTCCGGCAGAGATAGTGCACCACCAGCTCCTCGTCGGTGGGATGGAACCGGAAACC
                      ____________________________________________________________
consensus GCATTTCCGGCAGAGATAGTGAACCACGAGTTCCTCATCCGTCGGATGGAACCGGAAACC
 
. : . : . : . : . : . :
JMSF046B09+ GGGAGGTAACTCCAGCTGTGACTGCTTACTATCCTGAATTCCGCCGGTGCTCTTCATCTT
                      ____________________________________________________________
consensus GGGAGGTAACTCCAGCTGTGACTGCTTACTATCCTGAATTCCGCCGGTGCTCTTCATCTT
 
. : . : . : . : . : . :
JMSF046B09+ TTCTTTCTTCTTCTTCTTTTCTTCAGTGGAACTCGGGAGAGAAATGGGGGAAGATGCGAG
                      ____________________________________________________________
consensus TTCTTTCTTCTTCTTCTTTTCTTCAGTGGAACTCGGGAGAGAAATGGGGGAAGATGCGAG
 
. : . : . : . : . : . :
JMSF046B09+ GAAGCGGGTATATTTATACGAGCGAAGAGAATGAGATAGATTGAGCAGGCGCAGTAGTGC
                      ____________________________________________________________
consensus GAAGCGGGTATATTTATACGAGCGAAGAGAATGAGATAGATTGAGCAGGCGCAGTAGTGC
 
. : . : . : . : . : . :
JMSF046B09+ AATTTCACACGTGGTAAATTTCACCGGTGCGTAATCTGGAAAGTCGAGACGAGCTTTCTG
                      ____________________________________________________________
consensus AATTTCACACGTGGTAAATTTCACCGGTGCGTAATCTGGAAAGTCGAGACGAGCTTTCTG
 
. : . : . : . : . : . :
JMSF046B09+ GGGAGTGGTGGGGTTGGTCAGACCGCCGCCATTGACCGTGAGGAAGAGTGGGTTGTAGAA
                      ____________________________________________________________
consensus GGGAGTGGTGGGGTTGGTCAGACCGCCGCCATTGACCGTGAGGAAGAGTGGGTTGTAGAA
 
. : . : . : . : . : . :
JMSF046B09+ ACAGCGACGGACTAATGAGGGGAGACCACGTACACAGCCCGCGCACGGGAGGTGGTTTTG
                      ____________________________________________________________
consensus ACAGCGACGGACTAATGAGGGGAGACCACGTACACAGCCCGCGCACGGGAGGTGGTTTTG
 
. : . : . : . : . : . :
JMSF046B09+ TCACGGCTGCCGTCACCAATTTGGATGGGTTTGGTGGCCGACGTAAAGTCGGCTCTGAAA
                      ____________________________________________________________
consensus TCACGGCTGCCGTCACCAATTTGGATGGGTTTGGTGGCCGACGTAAAGTCGGCTCTGAAA
 
. : . : . : . : . : . :
JMSF046B09+ ACATGAAAAGGGCAGGGCAGCGCTCATGTGAGCCAGTCGACGGTTTTGGCTATGCCCCAC
                      ____________________________________________________________
consensus ACATGAAAAGGGCAGGGCAGCGCTCATGTGAGCCAGTCGACGGTTTTGGCTATGCCCCAC