Previous Contig 007702:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021C06Sequence468007702 (4)pir|T09915|T099154e-41hypothetical protein T16L4.30 - Arabidopsis thaliana>gb:ATCHRIV71_1546873 Arabid714007702 (4)gb:AY085283_15703553e-59Arabidopsis thaliana clone 142647 mRNA, complete sequence.
JMSF011D06Sequence322007702 (4)pir|T09915|T099159e-21hypothetical protein T16L4.30 - Arabidopsis thaliana>gb:ATCHRIV71_1546873 Arabid
JMSF046A18Sequence633007702 (4)pir|T09915|T099151e-66hypothetical protein T16L4.30 - Arabidopsis thaliana>gb:ATCHRIV71_1546873 Arabid762024190gb:AY085283_15703559e-49Arabidopsis thaliana clone 142647 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF021C06- GCAGTGTTGATTGAATTGGTATCAAAACTCAAAAGTTACAAATAGGA
                      ____________________________________________________________
consensus GCAGTGTTGATTGAATTGGTATCAAAACTCAAAAGTTACAAATAGGA
 
. : . : . : . : . : . :
rJMFF021C06- AAGGAGAAATGAGAAAAGCCTTCACTAACTACTACCAATCTCACACATCCTATCATCAAT
                      ____________________________________________________________
consensus AAGGAGAAATGAGAAAAGCCTTCACTAACTACTACCAATCTCACACATCCTATCATCAAT
 
. : . : . : . : . : . :
rJMFF021C06- TATATTGTTGGCCACTAGATCAGAGTTCAGCTTTACTGGACTTAGGCTTCTGTAATTGTT
                      ____________________________________________________________
consensus TATATTGTTGGCCACTAGATCAGAGTTCAGCTTTACTGGACTTAGGCTTCTGTAATTGTT
 
. : . : . : . : . : . :
rJMFF021C06- CCTTCTTTGATTTCAACCACTTCCTTAATCTGTAAGACAACCTGGTACTATGTTCTTTCA
                      ____________________________________________________________
consensus CCTTCTTTGATTTCAACCACTTCCTTAATCTGTAAGACAACCTGGTACTATGTTCTTTCA
 
. : . : . : . : . : . :
rJMFF021C06- CAGTCTTGGTTGCATCTTTAATTCCTTTGGTAATCCTCTGCTTCCAATCCGTCTCCGTAG
                      ____________________________________________________________
consensus CAGTCTTGGTTGCATCTTTAATTCCTTTGGTAATCCTCTGCTTCCAATCCGTCTCCGTAG
 
. : . : . : . : . : . :
rJMFF021C06- TTTCTTTTCCTTTAAGAACTTTACCCAAATTTTTTGGGAAGTCAGCCTCAGCCTCATCAT
                      ____________________________________________________________
consensus TTTCTTTTCCTTTAAGAACTTTACCCAAATTTTTTGGGAAGTCAGCCTCAGCCTCATCAT
 
. : . : . : . : . : . :
rJMFF021C06- CATCATCATCTTCGTCTGCATCTTCATCACCACCGAAGTTTTGGTTCATCAGATCTTCCC
                      ____________________________________________________________
consensus CATCATCATCTTCGTCTGCATCTTCATCACCACCGAAGTTTTGGTTCATCAGATCTTCCC
 
. : . : . : . : . : . :
rJMFF021C06- TGGAGTACATTTTCATGCCAGGTGCTCCCGGCATACCCTCCATGGATCTCAATAGCTTCT
                      ____________________________________________________________
consensus TGGAGTACATTTTCATGCCAGGTGCTCCCGGCATACCCTCCATGGATCTCAATAGCTTCT
 
. : . : . : . : . : . :
rJMFF021C06- CCATTTCTGCCTCTTTTGAGGATTTTGGAACAAATGGTTCCCCCGGTGTTCTATCCTTGG
JMSF046A18+ GAACAAATGGTTCCCCCGGTGTTCTATCCTTGG
                      ____________________________________________________________
consensus CCATTTCTGCCTCTTTTGAGGATTTTGGAACAAATGGTTCCCCCGGTGTTCTATCCTTGG
 
. : . : . : . : . : . :
rJMFF021C06- GGACTGGTGGTGGTTTCCTACTACATGCGTTGGTAACATCTTTGCAAAGGAAATTAACCA
JMSF046A18+ GGACTGGTGGTGGTTTCCTACTACATGCGTTGGTAACATCTTTGCAAAGGAAATTAACCA
                      ____________________________________________________________
consensus GGACTGGTGGTGGTTTCCTACTACATGCGTTGGTAACATCTTTGCAAAGGAAATTAACCA
 
. : . : . : . : . : . :
rJMFF021C06- GAGAATCAAGCTTGGGCTTGTGTGTGTACAAATATTCTGCCACATCAGTGTCGGAGAAGC
JMFF021C06+ GC
JMSF046A18+ GAGAATCAAGCTTGGGCTTGTGTGTGTACAAATATTCTGCCACATCAGTGTCGGAGAAGC
                      ____________________________________________________________
consensus GAGAATCAAGCTTGGGCTTGTGTGTGTACAAATATTCTGCCACATCAGTGTCGGAGAAGC
 
. : . : . : . : . : . :
rJMFF021C06- CCATAACCTCTTGACAAGCTTTTTCAATAGTTTTGCATTCTGAATTGCATTGTCCTTCTG
JMFF021C06+ CCATACCCTCTTGACAAGCTTTTTCAATAGTTTTGCATTCTGAATTGCATTGTCCTTCTG
JMSF046A18+ CCATAACCTCTTGACAAGCTTTTTCAATAGTTTTGCATTCTGAATTGCATTGTCCTTCTG
                      ____________________________________________________________
consensus CCATAACCTCTTGACAAGCTTTTTCAATAGTTTTGCATTCTGAATTGCATTGTCCTTCTG
 
. : . : . : . : . : . :
rJMFF021C06- CATCTTG
JMFF021C06+ CATCTTGTTCCACAAGCTCCAATTTATCCCCTTGTTCTACAATATCAATTTTGAGAATCC
JMSF046A18+ CATCTTGTTCCACAAGCTCCAATTTATCCCCTTGTTCTACAATATCAATTTTGAGAATCC
                      ____________________________________________________________
consensus CATCTTGTTCCACAAGCTCCAATTTATCCCCTTGTTCTACAATATCAATTTTGAGAATCC
 
. : . : . : . : . : . :
JMSF011D06+ CTGCTTCTTTAGATTACAAAGATTCTCTGAAATCTCTATTATCTGATACT
JMFF021C06+ AATCAGCTTCCTGCTTCTTTAGATTACAAAGATTCTCTGAAATCTCTATTATCTGATACT
JMSF046A18+ AATCAGCTTCCTGCTTCTTTAGATTACAAAGATTCTCTGAAATCTCTATTATCTGATACT
                      ____________________________________________________________
consensus AATCAGCTTCCTGCTTCTTTAGATTACAAAGATTCTCTGAAATCTCTATTATCTGATACT
 
. : . : . : . : . : . :
JMSF011D06+ CTGAGATCTTCTTGGGTGAGATCTCAGCTTGTTTGCTCTGAACTTGGTGGTATAGCTGAT
JMFF021C06+ CTGAGATCTTCTTGGGTGAGATCTCAGCTTGTTTGCTCTGAACTTGGTGGTATAGCTGAT
JMSF046A18+ CTGAGATCTTCTTGGGTGAGATCTCAGCTTGTTTGCTCTGAACTTGGTGGTATAGCTGAT
                      ____________________________________________________________
consensus CTGAGATCTTCTTGGGTGAGATCTCAGCTTGTTTGCTCTGAACTTGGTGGTATAGCTGAT
 
. : . : . : . : . : . :
JMSF011D06+ ATGCCAGCTTCTCACAGACCTGGCATTTAATATATGGAATGTCTTCTTTTCTTGCCACGC
JMFF021C06+ ATGCCAGCTTCTCACAGACCTGGCATTTAATATATGGAATGTCTTCTTTTCTTGCCACGC
JMSF046A18+ ATGCCAGCTTCTCACAGACCTGGCATTTAATATATGGAATGTCTTCTTTTCTTGCCACGC
                      ____________________________________________________________
consensus ATGCCAGCTTCTCACAGACCTGGCATTTAATATATGGAATGTCTTCTTTTCTTGCCACGC
 
. : . : . : . : . : . :
JMSF011D06+ CAACTGGCTTCTTTGCACACTGTGAAATTGGTAGCCATGATGATAGCACTACCAGAGACA
JMFF021C06+ CAACTGGCTTCTTTGCACACTGTGAAATTGGTAGCCATGATGATAGCACTACCAGAGACA
JMSF046A18+ CAACTGGCTTCTTTGCACACTGTGAAATTGGTAGCCATGATGATAGCACTACCAGAGACA
                      ____________________________________________________________
consensus CAACTGGCTTCTTTGCACACTGTGAAATTGGTAGCCATGATGATAGCACTACCAGAGACA
 
. : . : . : . : . : . :
JMSF011D06+ AGAATACTAACAATACCAAATTATTGAATTTAAGCATTTTTGTCTAATAAAACTTTTCTC
JMFF021C06+ AGAATACTAACAATACCAAATTATTGAATTTAAGCATTTTTGTCTAATAAAACTTTTCTC
JMSF046A18+ AGAATACTAACAATACCAAATTATTGAATTTAAGCATTTTTGTCTAATAAAACTTTTCTC
                      ____________________________________________________________
consensus AGAATACTAACAATACCAAATTATTGAATTTAAGCATTTTTGTCTAATAAAACTTTTCTC
 
. : . : . : . : . : . :
JMSF011D06+ TCTCTTTCTCTCTCTCTCTACCGAAATTTC
JMFF021C06+ TCTCTTTCTCTCTCTCTCTACCGAAATTTCGGAGATCTCAAT
JMSF046A18+ TCTCTTTCTCTCTCTCTCTACCGAAATTTCGGAGATCTCAATTAGAAACGAATCACCCCC
                      ____________________________________________________________
consensus TCTCTTTCTCTCTCTCTCTACCGAAATTTCGGAGATCTCAATTAGAAACGAATCACCCCC