Previous Contig 007693:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044E04Sequence643007693 (3)pir|T06604|T066041e-38hypothetical protein F16J13.40 - Arabidopsis thaliana>gb:ATCHRIV33_1544962 Arabi506013629 (3)pir|T06604|T066045e-04hypothetical protein F16J13.40 - Arabidopsis thaliana>gb:ATCHRIV33_1544962 Arabi
JMSF024M01Sequence684007693 (3)pir|T06604|T066045e-52hypothetical protein F16J13.40 - Arabidopsis thaliana>gb:ATCHRIV33_1544962 Arabi691013629 (3)pir|T06604|T066043e-09hypothetical protein F16J13.40 - Arabidopsis thaliana>gb:ATCHRIV33_1544962 Arabi
JMSF045O11Sequence719007693 (3)pir|T06604|T066049e-53hypothetical protein F16J13.40 - Arabidopsis thaliana>gb:ATCHRIV33_1544962 Arabi545013629 (3)pir|T06604|T066040.001hypothetical protein F16J13.40 - Arabidopsis thaliana>gb:ATCHRIV33_1544962 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024M01+ CTGAAAAGGCAAATCGTGCAACCGCAGCCATTTAACATTAAAACTGCGACCCCAAGGATT
JMSF045O11+ TGAAAAGGCAAATCGTGCAACCGCAGCCATTTAACATTAAAACTGCGACCCCAAGGATT
                      ____________________________________________________________
consensus CTGAAAAGGCAAATCGTGCAACCGCAGCCATTTAACATTAAAACTGCGACCCCAAGGATT
 
. : . : . : . : . : . :
JMSF024M01+ GCGCCCACTACTTCCTNGGCTCCAGACATGGTCACGTCTCCCAACAGATGATGTCATTTG
JMFF044E04+ GGCTCCAGACATGGTCACGTCTCCCAACAGATGATGTCATTTG
JMSF045O11+ GCGCCCACCACTTCCTTGGCTCCAGACATGGTCACGTCTCCCAACAGATGATGTCATTTG
                      ____________________________________________________________
consensus GCGCCCACTACTTCCTTGGCTCCAGACATGGTCACGTCTCCCAACAGATGATGTCATTTG
 
. : . : . : . : . : . :
JMSF024M01+ TGCATATCCTTGGAAGAAACCACTCATGTTGACACTAAATATTAGAATAACCTTCTTTGA
JMFF044E04+ TGCATATCCTGNGAAGAAACCACTCATGTGNACACTAAATATTAGAATAACCTTCTTTGA
JMSF045O11+ TGCATATCCTTGGAAGAAACCACTCATGTTGACACTAAATATTAGAATAACCTTCTTTGA
                      ____________________________________________________________
consensus TGCATATCCTTGGAAGAAACCACTCATGTTGACACTAAATATTAGAATAACCTTCTTTGA
 
. : . : . : . : . : . :
JMSF024M01+ ATTATGAAAGGCTTCCTCCAGAATATGCTCATTCATAACTTGTGTTGCCCAAATGCCTTT
JMFF044E04+ ATTATGAAAGGCTTCCTCCAGAATATGCTCATTCATAACTTGTGTTGCCCAAATGCCTTT
JMSF045O11+ ATTATGAAAGGCTTCCTCCAGAATATGCTCATTCATAACTTGTGTTGCCCAAATGCCTTT
                      ____________________________________________________________
consensus ATTATGAAAGGCTTCCTCCAGAATATGCTCATTCATAACTTGTGTTGCCCAAATGCCTTT
 
. : . : . : . : . : . :
JMSF024M01+ CTTTACTGACAATTGAAGGTTTTCATGGTTCAAACTCTTGATAATGAAATATCTTGTGCC
JMFF044E04+ CTTTACTGACAATTGAAGGTTTTCATGGTTCAAACTCTTGATAATGAAATATCTTGTGCC
JMSF045O11+ CTTTACTGACAATTGAAGGTTTTCATGGTTCAAACTCTTGATAATGAAATATCTTGTGCC
                      ____________________________________________________________
consensus CTTTACTGACAATTGAAGGTTTTCATGGTTCAAACTCTTGATAATGAAATATCTTGTGCC
 
. : . : . : . : . : . :
JMSF024M01+ ATGCAGCTTTCCATTCCCAACTGCAGCTGAAATGCCAATCTGATCACATGGGATTTCCTG
JMFF044E04+ ATGCAGCTTTCCATTCCCAACTGCAGCTGAAATGCCAATCTGATCACATGGGATTTCCTG
JMSF045O11+ ATGCAGCTTTCCATTCCCAACTGCAGCTGAAATGCCAATCTGATCACATGGGATTTCCTG
                      ____________________________________________________________
consensus ATGCAGCTTTCCATTCCCAACTGCAGCTGAAATGCCAATCTGATCACATGGGATTTCCTG
 
. : . : . : . : . : . :
JMSF024M01+ GTAATCTGCTCCAGAATGATAGGTATTGTTCTTCTCTCTATAGTTTGGGATATCTGGATC
JMFF044E04+ GTAATCTGCTCCAGAATGATAGGTATTGTTCTTCTCTCTATAGTTTGGGATATCTGGATC
JMSF045O11+ GTAATCTGCTCCAGAATGATAGGTATTGTTCTTCTCTCTATAGTTTGGGATATCTGGATC
                      ____________________________________________________________
consensus GTAATCTGCTCCAGAATGATAGGTATTGTTCTTCTCTCTATAGTTTGGGATATCTGGATC
 
. : . : . : . : . : . :
JMSF024M01+ ATCCATATTCCCTTTGTCATTTTTCCATTCAGTCCCCGATGATTCAACTACAGATACATT
JMFF044E04+ ATCCATATTCCCTTTGTCATTTTTCCATTCAGTCCCCGATGATTCAACTACAGATACATT
JMSF045O11+ ATCCATATTCCCTTTGTCATTTTTCCATTCAGTCCCCGATGATTCAACTACAGATACATT
                      ____________________________________________________________
consensus ATCCATATTCCCTTTGTCATTTTTCCATTCAGTCCCCGATGATTCAACTACAGATACATT
 
. : . : . : . : . : . :
JMSF024M01+ TTCTTTTGCAGTATCTGATGACATATCTTGGACACCTTCTATAACATGGTCGCAACAGAA
JMFF044E04+ TTCTTTTGCAGTATCTGATGACATATCTTGGACACCTTCTATAACATGGTCGCAACAGAA
JMSF045O11+ TTCTTTTGCAGTATCTGATGACATATCTTGGACACCTTCTATAACATGGTCGCAACAGAA
                      ____________________________________________________________
consensus TTCTTTTGCAGTATCTGATGACATATCTTGGACACCTTCTATAACATGGTCGCAACAGAA
 
. : . : . : . : . : . :
JMSF024M01+ TGATGGTGGACACAAATTAGATCTAAAAGTACTCCTGCGACGCTGCCCGTTTGCCTCCTC
JMFF044E04+ TGATGGTGGACACAAATTAGATCTAAAAGTACTCCTGCGACGCTGCCCGTTTGCCTCCTC
JMSF045O11+ TGATGGTGGACACAAATTAGATCTAAAAGTACTCCTGCAACGCTGCCCGTTTGCCTCCTC
                      ____________________________________________________________
consensus TGATGGTGGACACAAATTAGATCTAAAAGTACTCCTGCGACGCTGCCCGTTTGCCTCCTC
 
. : . : . : . : . : . :
JMSF024M01+ GCCGGTAGCTCGCCGCCCCGCCGCCGCCAGTCGTCCGCTCGTCGCAGGAACGCCGTCTGA
JMFF044E04+ GCCGGTAGCTCGCCGCCCCGCCGCCGCCAGTCGTCCGCTCGTCGCAGGAACGCCGTCTGA
JMSF045O11+ GCCGGTAGCTCGCCGCCCCGCCGCCGCCAGTCGTCCGCTCGTCGCAGGAACGCCGTCTGA
                      ____________________________________________________________
consensus GCCGGTAGCTCGCCGCCCCGCCGCCGCCAGTCGTCCGCTCGTCGCAGGAACGCCGTCTGA
 
. : . : . : . : . : . :
JMSF024M01+ CCGTCTCGCAAAATCGCAGACA
JMFF044E04+ CCGTCTCGCAAAATCGCAGACACAGGAAGTCAGAACTCAACGAAAGTAATTGATTTACC
JMSF045O11+ CCGTCTCGCAAAATCGCAGACACAGGAAGTCAGAACTCAACGAAAGTAATTGATTTACCC
                      ____________________________________________________________
consensus CCGTCTCGCAAAATCGCAGACACAGGAAGTCAGAACTCAACGAAAGTAATTGATTTACCC