Previous Contig 007689:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS013A11Sequence599007689 (3)pir|D96767|D967674e-28unknown protein F2P9.16 [imported] - Arabidopsis thaliana>gb:AE005173_894942 Ara
JMFS133D04Sequence613007689 (3)pir|D96767|D967672e-28unknown protein F2P9.16 [imported] - Arabidopsis thaliana>gb:AE005173_894942 Ara
JMSF045M08Sequence750007689 (3)pir|D96767|D967672e-34unknown protein F2P9.16 [imported] - Arabidopsis thaliana>gb:AE005173_894942 Ara709024176

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045M08+ TCAGACATGCAGATCAATTTAAAATCTTGT
                      ____________________________________________________________
consensus TCAGACATGCAGATCAATTTAAAATCTTGT
 
. : . : . : . : . : . :
JMFS013A11+ GATGCTGAAGTT
JMFS133D04+ GATGCTGAAGTT
JMSF045M08+ TCAAGTAGCATGCAGAGCATCTCTAGGCAGGCCTTTCTAGATTTCTCTGATGCTGAAGTT
                      ____________________________________________________________
consensus TCAAGTAGCATGCAGAGCATCTCTAGGCAGGCCTTTCTAGATTTCTCTGATGCTGAAGTT
 
. : . : . : . : . : . :
JMFS013A11+ ACAAAAGAAAGGGCACCAAGTAGAAGAACACCTTCAGAGTAGAAAACAGAGATTTTTTCA
JMFS133D04+ ACAAAAGAAAGGGCACCAAGTAGAAGAACACCTTCAGAGTAGAAAACAGAGATTTTTTCA
JMSF045M08+ ACAAAAGAAAGGGCACCAAGTAGAAGAACACCTTCAGAGTAGAAAACAGAGATTTTTTCA
                      ____________________________________________________________
consensus ACAAAAGAAAGGGCACCAAGTAGAAGAACACCTTCAGAGTAGAAAACAGAGATTTTTTCA
 
. : . : . : . : . : . :
JMFS013A11+ GAATGCAAATGTACAGAGAAAAGGTTCAAGAGAACCTCAACAGCATAATCAACAACAAGA
JMFS133D04+ GAATGCAAATGTACAGAGAAAAGGTTCAAGAGAACCTCAACAGCATAATCAACAACAAGA
JMSF045M08+ GAATGCAAATGTACAGAGAAAAGGTTCAAGAGAACCTCAACAGCATAATCAACAACAAGA
                      ____________________________________________________________
consensus GAATGCAAATGTACAGAGAAAAGGTTCAAGAGAACCTCAACAGCATAATCAACAACAAGA
 
. : . : . : . : . : . :
JMFS013A11+ GAAGAGGGTCTGGATGATTTCCTAATCCAGATATACAGAAGTTTCAGAAGTAAAGAATAA
JMFS133D04+ GAAGAGGGTCTGGATGATTTCCTAATCCAGATATACAGAAGTTTCAGAAGTAAAGAATAA
JMSF045M08+ GAAGAGGGTCTGGATGATTTCCTAATCCAGATATACAGAAGTTTCAGAAGTAAAGAATAA
                      ____________________________________________________________
consensus GAAGAGGGTCTGGATGATTTCCTAATCCAGATATACAGAAGTTTCAGAAGTAAAGAATAA
 
. : . : . : . : . : . :
JMFS013A11+ GATTCCTGTGGGAGGGAGATTTTAGGTGAGGACATAAGAGAGAGTAGAAGTTTTGCTTGT
JMFS133D04+ GATTCCTGTGGGAGGGAGATTTTAGGTGAGGACATAAGAGAGAGTAGAAGTTTTGCTTGT
JMSF045M08+ GATTCCTGTGGGAGGGAGATTTTAGGTGAGGACATAAGAGAGAGTAGAAGTTTTGCTTGT
                      ____________________________________________________________
consensus GATTCCTGTGGGAGGGAGATTTTAGGTGAGGACATAAGAGAGAGTAGAAGTTTTGCTTGT
 
. : . : . : . : . : . :
JMFS013A11+ GGATCAGCAATATACAGTGAGTTTTGAGAGGTAACAAGAGTATGCAAAGATTGGAGGTTA
JMFS133D04+ GGATCAGCAATATACAGTGAGTTTTGAGAGGTAACAAGAGTATGCAAAGATTGGAGGTTA
JMSF045M08+ GGATCAGCAATATACAGTGAGTTTTGAGAGGTAACAAGAGTATGCAAAGATTGGAGGTTA
                      ____________________________________________________________
consensus GGATCAGCAATATACAGTGAGTTTTGAGAGGTAACAAGAGTATGCAAAGATTGGAGGTTA
 
. : . : . : . : . : . :
JMFS013A11+ TGAGAATTGAAGGCCTGTTGTTGAACTGAATCCCGCAAATCTGCCCATGCTTGTATTATG
JMFS133D04+ TGAGAATTGAAGGCCTGTTGTTGAACTGAATCCCGCAAATCTGCCCATGCTTGTATTATG
JMSF045M08+ TGAGAATTGAAGGCCTGTTGTTGAACTGAATCCCGCAAATCTGCCCATGCTTGTATTATG
                      ____________________________________________________________
consensus TGAGAATTGAAGGCCTGTTGTTGAACTGAATCCCGCAAATCTGCCCATGCTTGTATTATG
 
. : . : . : . : . : . :
JMFS013A11+ GCTTGAGCAGATGTCAAAGATGGCTGTCTTGAGCTCACACTGCTGCTGCTCCCACCAATG
JMFS133D04+ GCTTGAGCAGATGTCAAAGATGGCTGTCTTGAGCTCACACTGCTGCTGCTCCCACCAATG
JMSF045M08+ GCTTGAGCAGATGTCAAAGATGGCTGTCTTGAGCTCACACTGCTGCTGCTCCCACCAATG
                      ____________________________________________________________
consensus GCTTGAGCAGATGTCAAAGATGGCTGTCTTGAGCTCACACTGCTGCTGCTCCCACCAATG
 
. : . : . : . : . : . :
JMFS013A11+ ATGCTTTGCAGCCATACTTCAAGGAAAACTGTTTGAGATTGCTTAGCCATCTTGTGACTT
JMFS133D04+ ATGCTTTGCAGCCATACTTCAAGGAAAACTGTTTGAGATTGCTTAGCCATCTTGTGACTT
JMSF045M08+ ATGCTTTGCAGCCATACTTCAAGGAAAACTGTTTGAGATTGCTTAGCCATCTTGTGACTT
                      ____________________________________________________________
consensus ATGCTTTGCAGCCATACTTCAAGGAAAACTGTTTGAGATTGCTTAGCCATCTTGTGACTT
 
. : . : . : . : . : . :
JMFS013A11+ CCACCTTACACGGCAGTACTGTCGATGCTGAGCTCCACAAAATTTCTCGCGGGGCAACAA
JMFS133D04+ CCACCTTACACGGCAGTACTGTCGATGCTGAGCTCCACAAAATTTCTCGCGGGGCAACAA
JMSF045M08+ CCACCTTACACGGCAGTACTGTCGATGCTGAGCTCCACAAAATTTCTCGCGGGGCAACAA
                      ____________________________________________________________
consensus CCACCTTACACGGCAGTACTGTCGATGCTGAGCTCCACAAAATTTCTCGCGGGGCAACAA
 
. : . : . : . : . : . :
JMFS013A11+ GATTCTACTCTCTAACAAAGCAAGCCAAGTTCTGCAACTAAAGCAGT
JMFS133D04+ GATTCTACTCTCTAACAAAGCAAGCCAAGTTCTGCAACTAAAGCAGTGGGAAACTTCGA
JMSF045M08+ GATTCTACTCTCTAACAAAGCAAGCCAAGTTCTGCAACTAAAGCAGTGGGAAACTTCGAT
                      ____________________________________________________________
consensus GATTCTACTCTCTAACAAAGCAAGCCAAGTTCTGCAACTAAAGCAGTGGGAAACTTCGAT
 
. : . : . : . : . : . :
JMSF045M08+ TTCTGTTTTTTTTTCTTCTCCCAGTTTATAATCTATTATCTATATATCAGTCTTTTAGTC
                      ____________________________________________________________
consensus TTCTGTTTTTTTTTCTTCTCCCAGTTTATAATCTATTATCTATATATCAGTCTTTTAGTC