Previous Contig 007671:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004C23Sequence562007671 (2)pir|H86303|H863035e-37hypothetical protein F6I1.14 [imported] - Arabidopsis thaliana>gb:AE005172_89066354020719
JMSF045I05Sequence798007671 (2)pir|C96818|C968186e-70hypothetical protein F9K20.7 [imported] - Arabidopsis thaliana>gb:AE005173_89540820013616 (2)gb:AP004559_18415631e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P046

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045I05+ AATAGAAGGACCATGCAT
                      ____________________________________________________________
consensus AATAGAAGGACCATGCAT
 
. : . : . : . : . : . :
JMSF045I05+ TTTCATAGAGCCCATCGAATCCAATGGACCAGAGACCTTTCTCGGTGCCCCAGAAGAATT
                      ____________________________________________________________
consensus TTTCATAGAGCCCATCGAATCCAATGGACCAGAGACCTTTCTCGGTGCCCCAGAAGAATT
 
. : . : . : . : . : . :
JMSF045I05+ TAGTGGGCCCGAAGAGATGGGACCAGAAGTGATCAGACCAGTTGCTGGGAGAACTGGCGG
                      ____________________________________________________________
consensus TAGTGGGCCCGAAGAGATGGGACCAGAAGTGATCAGACCAGTTGCTGGGAGAACTGGCGG
 
. : . : . : . : . : . :
JMSF045I05+ TTGAGGACCTGAGTTTTGGCGTCCAGTTGCTCCACCAGATTGAGGTCCCGACACCTTTTT
                      ____________________________________________________________
consensus TTGAGGACCTGAGTTTTGGCGTCCAGTTGCTCCACCAGATTGAGGTCCCGACACCTTTTT
 
. : . : . : . : . : . :
JMSF045I05+ CATAGGCTCCCCGTGCTTATTAAGAGGCCCGGAATTGGATTTCTTCATTGAAGCCGAACC
                      ____________________________________________________________
consensus CATAGGCTCCCCGTGCTTATTAAGAGGCCCGGAATTGGATTTCTTCATTGAAGCCGAACC
 
. : . : . : . : . : . :
JMSF045I05+ AGTCACCATTGTGGAAGAAAAAGGACCCGAGGAGTAACTGGCCCTGGCAGCAGCGTTAGG
                      ____________________________________________________________
consensus AGTCACCATTGTGGAAGAAAAAGGACCCGAGGAGTAACTGGCCCTGGCAGCAGCGTTAGG
 
. : . : . : . : . : . :
JMSF045I05+ ATTGATAGGCCCTGAATGAGTTCTGGAAGGAGCATTAGAAATGGGCCCAGATTTTCTCGA
                      ____________________________________________________________
consensus ATTGATAGGCCCTGAATGAGTTCTGGAAGGAGCATTAGAAATGGGCCCAGATTTTCTCGA
 
. : . : . : . : . : . :
JMFF004C23+ CCATCCACAGGGATATCAAACATTTTCCCAAGTTCTCCAGACTTCTTGATGTC
JMSF045I05+ CTTAGACCCATCCATAGGAATGTCAAACATTTTTCCAAGTTCTCCAGACTTCTTGATGTC
                      ____________________________________________________________
consensus CTTAGACCCATCCATAGGGATGTCAAACATTTTTCCAAGTTCTCCAGACTTCTTGATGTC
 
. : . : . : . : . : . :
JMFF004C23+ ACCACCAGTATAAGGCATGGCAACAAAACTCATTGTTGGTGTCCTTTCTTTTGGCTGCTC
JMSF045I05+ ACCACCAGTATAGGGCATGGCCACCGAACTCATTGTTGGGGGTCTTTCTTTTGGCTGTTC
                      ____________________________________________________________
consensus ACCACCAGTATAGGGCATGGCCACCGAACTCATTGTTGGTGTTCTTTCTTTTGGCTGTTC
 
. : . : . : . : . : . :
JMFF004C23+ AGGCCGTCCTGACACGTATAGCCCATTGCTGAGCTGGTGAGATGGGAATCTAGAACCCAT
JMSF045I05+ AGGCCGACCCGACACATAGAGCCCATTGCTGAGCTGGTGAGATGGGAATCTAGAACCCAT
                      ____________________________________________________________
consensus AGGCCGTCCTGACACGTATAGCCCATTGCTGAGCTGGTGAGATGGGAATCTAGAACCCAT
 
. : . : . : . : . : . :
JMFF004C23+ CA
JMSF045I05+ CAAGCTACCTTATGAAGCAAACCCTGAGAAAGATGCAGATCAAAAAATCTGAAGAGAGTA
                      ____________________________________________________________
consensus CAAGCTACCTTATGAAGCAAACCCTGAGAAAGATGCAGATCAAAAAATCTGAAGAGAGTA
 
. : . : . : . : . : . :
JMSF045I05+ GAAGGCACCTTTTTGAAAATGTTACTTGTCAGGGGCTCCGTTTGTTCGTACTAGTAGCTA
                      ____________________________________________________________
consensus GAAGGCACCTTTTTGAAAATGTTACTTGTCAGGGGCTCCGTTTGTTCGTACTAGTAGCTA
 
. : . : . : . : . : . :
JMSF045I05+ ATGCGATCCCATCAACATCTCTCTTTCTTTCTCTCTCTATGAATCTTCAGAAACCCGCAA
                      ____________________________________________________________
consensus ATGCGATCCCATCAACATCTCTCTTTCTTTCTCTCTCTATGAATCTTCAGAAACCCGCAA
 
. : . : . : . : . : . :
JMSF045I05+ CAACTGGTGGGTTGTCTCGTCCGGCAATAACCACCAGCCCAGATAATAAACCAACAAACC
                      ____________________________________________________________
consensus CAACTGGTGGGTTGTCTCGTCCGGCAATAACCACCAGCCCAGATAATAAACCAACAAACC