Previous Contig 007667:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS166A04Sequence605007667 (3)pir|A96777|A967773e-32hypothetical protein F25A4.26 [imported] - Arabidopsis thaliana>gb:AE005173_8950
JMSF038A08Sequence662007667 (3)pir|A96777|A967771e-54hypothetical protein F25A4.26 [imported] - Arabidopsis thaliana>gb:AE005173_8950847023792pir|H96776|H967766e-54hypothetical protein F25A4.27 [imported] - Arabidopsis thaliana>gb:AE005173_8950
JMSF045H11Sequence688007667 (3)pir|A96777|A967771e-35hypothetical protein F25A4.26 [imported] - Arabidopsis thaliana>gb:AE005173_8950867024156pir|H96776|H967761e-76hypothetical protein F25A4.27 [imported] - Arabidopsis thaliana>gb:AE005173_8950

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038A08+ CTGAAGACAATGTAGTAGTCAGCCACGGTAGGAATTCTTCCAGCA
                      ____________________________________________________________
consensus CTGAAGACAATGTAGTAGTCAGCCACGGTAGGAATTCTTCCAGCA
 
. : . : . : . : . : . :
JMSF038A08+ GAATAATAGGAACACTACACAGATACTGCCATACAAGCTTAGCCTGTTCTTTGGGAGAAA
                      ____________________________________________________________
consensus GAATAATAGGAACACTACACAGATACTGCCATACAAGCTTAGCCTGTTCTTTGGGAGAAA
 
. : . : . : . : . : . :
JMSF038A08+ AATGCTGCACCAACAAAGGAAAAATCTGCTCTTCTTCTTTCAGCATATGCTGACTCATGA
JMFS166A04+ GACTCATGA
JMSF045H11+ TCTTCTTTCAGCATATGCTGACTCATGA
                      ____________________________________________________________
consensus AATGCTGCACCAACAAAGGAAAAATCTGCTCTTCTTCTTTCAGCATATGCTGACTCATGA
 
. : . : . : . : . : . :
JMSF038A08+ TGGTCCACAAAGTACCTATGCAAATTATAAGTTCTTTAAACAAATTGAGCAAAGTTTCAC
JMFS166A04+ TGGTCCACAAAGTACCTATGCAAATTATAAGTTCTTTAAACAAATTGAGCAAAGTTTCAC
JMSF045H11+ TGGTCCACAAAGTACCTATGCAAATTATAAGTTCTTTAAACAAATTGAGCAAAGTTTCAC
                      ____________________________________________________________
consensus TGGTCCACAAAGTACCTATGCAAATTATAAGTTCTTTAAACAAATTGAGCAAAGTTTCAC
 
. : . : . : . : . : . :
JMSF038A08+ TTTCCTTCTTCAGGAGATCCAAGTAATGGAAGATAGAAACAAACAGATCATCTATGCTTC
JMFS166A04+ TTTCCTTCTTCAGGAGATCCAAGTAATGGAAGATAGAAACAAACAGATCATCTATGCTTC
JMSF045H11+ TTTCCTTCTTCAGGAGATCCAAGTAATGGAAGATAGAAACAAACAGATCATCTATGCTTC
                      ____________________________________________________________
consensus TTTCCTTCTTCAGGAGATCCAAGTAATGGAAGATAGAAACAAACAGATCATCTATGCTTC
 
. : . : . : . : . : . :
JMSF038A08+ TATGTTCGAGTGAATATGTACAAACCACATTCTTCACATGTGCATCTAGTGCAAGAAAGA
JMFS166A04+ TATGTTCGAGTGAATATGTACAAACCACATTCTTCACATGTGCATCTAGTGCAAGAAAGA
JMSF045H11+ TATGTTCGAGTGAATATGTACAAACCACATTCTTCACATGTGCATCTAGTGCAAGAAAGA
                      ____________________________________________________________
consensus TATGTTCGAGTGAATATGTACAAACCACATTCTTCACATGTGCATCTAGTGCAAGAAAGA
 
. : . : . : . : . : . :
JMSF038A08+ TGACCTCATCTTCTGCAGCACAATGGTATTTACAGACTAGTTTCAAGAAGTCAAACCTCC
JMFS166A04+ TGACCTCATCTTCTGCAGCACAATGGTATTTACAGACTAGTTTCAAGAAGTCAAACCTCC
JMSF045H11+ TGACCTCATCTTCTGCAGCACAATGGTATTTACAGACTAGTTTCAAGAAGTCAAACCTCC
                      ____________________________________________________________
consensus TGACCTCATCTTCTGCAGCACAATGGTATTTACAGACTAGTTTCAAGAAGTCAAACCTCC
 
. : . : . : . : . : . :
JMSF038A08+ TTCTAAGCTCGTCAACGAGGTCAAGGCCAAGGGACCCATTCCCCGAGGCGGCCTCCACCG
JMFS166A04+ TTCTAAGCTCGTCAACGAGGTCAAGGCCAAGGGACCCATTCCCCGAGGCGGCCTCCACCG
JMSF045H11+ TTNTAAGCTCGTCAACGAGGTCAAGGCCAAGGGACCCATTCCCCGAGGCGGCCTCCACCG
                      ____________________________________________________________
consensus TTCTAAGCTCGTCAACGAGGTCAAGGCCAAGGGACCCATTCCCCGAGGCGGCCTCCACCG
 
. : . : . : . : . : . :
JMSF038A08+ CCACGCGGCGGAGCTGAGCTAGCTCAGATCTCAGGGCCTTATGAAAAACAGCGAGGAAAA
JMFS166A04+ CCACGCGGCGGAGCTGAGCTAGCTCAGATCTCAGGGCCTTATGAAAAACAGCGAGGAAAA
JMSF045H11+ CCACGCGGCGGAGCTGAGCTAGCTCAGATCTCAGGGCCTTATGAAAAACAGCGAGGAAAA
                      ____________________________________________________________
consensus CCACGCGGCGGAGCTGAGCTAGCTCAGATCTCAGGGCCTTATGAAAAACAGCGAGGAAAA
 
. : . : . : . : . : . :
JMSF038A08+ GAATCGGGGAGTCAACCAGCTTGAGAGCAGCAAGTGAAGGCGACAGGAAATCCTCCTCCG
JMFS166A04+ GAATCGGGGAGTCAACCAGCTTGAGAGCAGCAAGTGAAGGCGACAGGAAATCCTCCTCCG
JMSF045H11+ GAATCGGGGAGTCAACCAGCTTGAGAGCAGCAAGTGAAGGCGACAGGAAATCCTCCTCCG
                      ____________________________________________________________
consensus GAATCGGGGAGTCAACCAGCTTGAGAGCAGCAAGTGAAGGCGACAGGAAATCCTCCTCCG
 
. : . : . : . : . : . :
JMSF038A08+ TCTCGGGTTCTCCGCCGCCCATTTTCAGACGCAGCGCCACCACCACCACCACCTATCATC
JMFS166A04+ TCTCGGGTTCTCCGCCGCCCATTTTCAGACGCAGCGCCACCACCACCACCACCTATCATC
JMSF045H11+ TCTCGGGTTCTCCGCCGCCCATTTTCAGACGCAGCGCCACCACCACCACCACCTATCATC
                      ____________________________________________________________
consensus TCTCGGGTTCTCCGCCGCCCATTTTCAGACGCAGCGCCACCACCACCACCACCTATCATC
 
. : . : . : . : . : . :
JMSF038A08+ AACGGCGAGAGAGAC
JMFS166A04+ AACGGCGAGAGAGACCAAAGGGGAAGCTTCAACATTGAAGGTGGAGGAGTATATATGGGT
JMSF045H11+ AACGGCGAGAGAGACCAAAGGGGAAGCTTCAACATTGAAGGTGGAGGAGTATATATGGGT
                      ____________________________________________________________
consensus AACGGCGAGAGAGACCAAAGGGGAAGCTTCAACATTGAAGGTGGAGGAGTATATATGGGT
 
. : . : . : . : . : . :
JMFS166A04+ GCTTGTGGGCTCTCACAGTCTTGTTTTTTTTTGTGCAAGAAGGCGTTGTTGGTGCC
JMSF045H11+ GCTTGTGGGCTCTCACAGTCTTGTTTTTTTTTGTGCAAGAAGGCGTTGTTGGTGCCTCTC
                      ____________________________________________________________
consensus GCTTGTGGGCTCTCACAGTCTTGTTTTTTTTTGTGCAAGAAGGCGTTGTTGGTGCCTCTC
 
. : . : . : . : . : . :
JMSF045H11+ CCATGTCCAAATCGCAATTTTTTTGGGAATTTAAAAATTGGGTTTTGGGTTTTTGCGATC
                      ____________________________________________________________
consensus CCATGTCCAAATCGCAATTTTTTTGGGAATTTAAAAATTGGGTTTTGGGTTTTTGCGATC