Previous Contig 007664:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031E20Sequence122007664 (2)669013610 (4)gb:AC132492_17412086e-24Oryza sativa (japonica cultivar-group) chromosome 5 clone P0605G01, complete seq
JMSF045G15Sequence489007664 (2)711013610 (4)gb:AY087409_15724402e-14Arabidopsis thaliana clone 35075 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045G15+ ACTAGATAC
                      ____________________________________________________________
consensus ACTAGATAC
 
. : . : . : . : . : . :
JMSF045G15+ TTCACANTCATAAATGANTAAAATGAGCNNTTTGCCCCAACTCAAAGAACCTCAACTTCC
                      ____________________________________________________________
consensus TTCACANTCATAAATGANTAAAATGAGCNNTTTGCCCCAACTCAAAGAACCTCAACTTCC
 
. : . : . : . : . : . :
JMSF045G15+ CANGTNTACAAAACACGGCANTGCATTTCAGGTAGAGANCAAATCTCACAGGAATTCCAT
                      ____________________________________________________________
consensus CANGTNTACAAAACACGGCANTGCATTTCAGGTAGAGANCAAATCTCACAGGAATTCCAT
 
. : . : . : . : . : . :
JMSF045G15+ AGATCTATCCCAGGAAAAGCTCANGANNTAAACTTTAGCATAGAAAAAGAAAACCCAGAC
                      ____________________________________________________________
consensus AGATCTATCCCAGGAAAAGCTCANGANNTAAACTTTAGCATAGAAAAAGAAAACCCAGAC
 
. : . : . : . : . : . :
JMSF045G15+ TCATAGTTCACANGAACATCAAGAAAAACCCACANTTACANGGGAAAGTAATGANGAAAA
                      ____________________________________________________________
consensus TCATAGTTCACANGAACATCAAGAAAAACCCACANTTACANGGGAAAGTAATGANGAAAA
 
. : . : . : . : . : . :
JMSF045G15+ GCGTTAAATAAAACANGAAAATAAACGGAAAAAGTCNGANGAGANTCNTACACGGANGAA
                      ____________________________________________________________
consensus GCGTTAAATAAAACANGAAAATAAACGGAAAAAGTCNGANGAGANTCNTACACGGANGAA
 
. : . : . : . : . : . :
JMFF031E20+ TACATAAGCGTCAATAATTGC
JMSF045G15+ AAGGAGAGTTCCNTGAGAGATCTGGGNGTNCAAATNTTTTACATAAGCGTCAATAATTGC
                      ____________________________________________________________
consensus AAGGAGAGTTCCNTGAGAGATCTGGGNGTNCAAATNTTTTACATAAGCGTCAATAATTGC
 
. : . : . : . : . : . :
JMFF031E20+ AGAGGAAGAGAGAGAATGGTACCCACGTCAGGCAGGTATTCTCANTCCCTCTCTCTCTCT
JMSF045G15+ AGAGGAAGAGAGAGANTGGTACCCANGTCNGGCAGGTATTCTCNNTCCCTCTCTCTCTCT
                      ____________________________________________________________
consensus AGAGGAAGAGAGAGAATGGTACCCACGTCAGGCAGGTATTCTCANTCCCTCTCTCTCTCT
 
. : . : . : . : . : . :
JMFF031E20+ CTCTCTCTCTCTCTCTCTCTCCTCCACAATTCTTGAACTTT
JMSF045G15+ CTCTCTCTCTCTCTCTCTCTCCTCCACAATTCTTGAACTTTAGGTAAAGATAGTATTCTC
                      ____________________________________________________________
consensus CTCTCTCTCTCTCTCTCTCTCCTCCACAATTCTTGAACTTTAGGTAAAGATAGTATTCTC