Previous Contig 007661:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF027I18Sequence626007661 (3)gb:AC084221_17333931e-58Arabidopsis thaliana chromosome 1 BAC F14G11 genomic sequence, complete sequence729013604 (3)gb:AP002913_18239167e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048
JMSF037L12Sequence702007661 (3)gb:AC084221_17333935e-76Arabidopsis thaliana chromosome 1 BAC F14G11 genomic sequence, complete sequence729013604 (3)gb:AP002913_18239165e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048
JMSF045F04Sequence718007661 (3)gb:AC084221_17333933e-62Arabidopsis thaliana chromosome 1 BAC F14G11 genomic sequence, complete sequence764013604 (3)gb:AP002913_18239161e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037L12+ GAATTCA
                      ____________________________________________________________
consensus GAATTCA
 
. : . : . : . : . : . :
JMSF037L12+ GCATCCGATTGCCAGGACCTGCCGAACCGATCCGTATCGTTGCTGAATCCGGGTCCCCAC
                      ____________________________________________________________
consensus GCATCCGATTGCCAGGACCTGCCGAACCGATCCGTATCGTTGCTGAATCCGGGTCCCCAC
 
. : . : . : . : . : . :
JMSF037L12+ TGTTCGGACCCGCTCGAAAACCTACCATAATTCACCAATATAGATGTGTTCAACGAGGAC
JMSF045F04+ CCCGCTCGAAAACCTACCATAATTCACCAATATAGATGTGTTCAACGAGGAC
                      ____________________________________________________________
consensus TGTTCGGACCCGCTCGAAAACCTACCATAATTCACCAATATAGATGTGTTCAACGAGGAC
 
. : . : . : . : . : . :
JMSF037L12+ CGAATTGTACTATCGTTGACTAAATACGACTCTGGATCGACTTGAGTCAGCTCAAGCGAC
JMSF027I18+ TGGATCGACTTGAGTCAGCTCAAGCGAC
JMSF045F04+ CGAATTGTACTATCGTTGACTAAATACGACTCTGGATCGACTTGAGTCAGCTCAAGCGAC
                      ____________________________________________________________
consensus CGAATTGTACTATCGTTGACTAAATACGACTCTGGATCGACTTGAGTCAGCTCAAGCGAC
 
. : . : . : . : . : . :
JMSF037L12+ GCAATGACCGGAGAATCAGTGGCAATACTGTAAAAACAGATGTCGGCCTCCGAATCGGCG
JMSF027I18+ GCAATGACCGGAGAATCAGTGGCAATACTGTAAAAACAGATGTCGGCCTCCGAATCGGCG
JMSF045F04+ GCAATGACCGGAGAATCAGTGGCAATACTGTAAAAACAGATGTCGGCCTCCGAATCGGCG
                      ____________________________________________________________
consensus GCAATGACCGGAGAATCAGTGGCAATACTGTAAAAACAGATGTCGGCCTCCGAATCGGCG
 
. : . : . : . : . : . :
JMSF037L12+ ACGGTGAAGAACAGATCCGAGTAGGCTCCGGACCTGGAAATGGACTCCGTCCACGGCGAA
JMSF027I18+ ACGGTGAAGAACAGATCCGAGTAGGCTCCGGACCTGGAAATGGACTCCGTCCACGGCGAA
JMSF045F04+ ACGGTGAAGAACAGATCCGAGTAGGCTCCGGACCTGGAAATGGACTCCGTCCACGGCGAA
                      ____________________________________________________________
consensus ACGGTGAAGAACAGATCCGAGTAGGCTCCGGACCTGGAAATGGACTCCGTCCACGGCGAA
 
. : . : . : . : . : . :
JMSF037L12+ CGCCACGAAAAGACCAAATTACCCTCGACAGAAACATCAAAGGACGGGGACTGTGACTTC
JMSF027I18+ CGCCACGAAAAGACCAAATTACCCTCGACAGAAACATCAAAGGACGGGGACTGTGACTTC
JMSF045F04+ CGCCACGAAAAGACCAAATTACCCTCGACAGAAACATCAAAGGACGGGGACTGTGACTTC
                      ____________________________________________________________
consensus CGCCACGAAAAGACCAAATTACCCTCGACAGAAACATCAAAGGACGGGGACTGTGACTTC
 
. : . : . : . : . : . :
JMSF037L12+ CCGTCGAAGTTATCGTACACAGTAAAGGTGCGGAGGAGGTACTTCCCAGCGGGAAGGTCA
JMSF027I18+ CCGTCGAAGTTATCGTACACAGTAAAGGTGCGGAGGAGGTACTTCCCAGCGGGAAGGTCA
JMSF045F04+ CCGTCGAAGTTATCGTACACAGTAAAGGTGCGGAGGAGGTACTTCCCAGCGGGAAGGTCA
                      ____________________________________________________________
consensus CCGTCGAAGTTATCGTACACAGTAAAGGTGCGGAGGAGGTACTTCCCAGCGGGAAGGTCA
 
. : . : . : . : . : . :
JMSF037L12+ GGGATAACGTAGCAATTCTTCTTACCGGAGGCGATTGGGAAGAAGCGGAGAGTCTTCTCC
JMSF027I18+ GGGATAACGTAGCAATTCTTCTTACCGGAGGCGATTGGGAAGAAGCGGAGAGTCTTCTCC
JMSF045F04+ GGGATAACGTAGCAATTCTTCTTACCGGAGGCGATTGGGAAGAAGCGGAGAGTCTTCTCC
                      ____________________________________________________________
consensus GGGATAACGTAGCAATTCTTCTTACCGGAGGCGATTGGGAAGAAGCGGAGAGTCTTCTCC
 
. : . : . : . : . : . :
JMSF037L12+ TGCTGGTGCTTAAACTGAAGCGGCTCCGACACAATGGCGGTGTCACCGCCGGTGTAGTAG
JMSF027I18+ TGCTGGTGCTTAAACTGAAGCGGCTCCGACACAATGGCGGTGTCACCGCCGGTGTAGTAG
JMSF045F04+ TGCTGGTGCTTAAACTGAAGCGGCTCCGACACAATGGCGGTGTCACCGCCGGTGTAGTAG
                      ____________________________________________________________
consensus TGCTGGTGCTTAAACTGAAGCGGCTCCGACACAATGGCGGTGTCACCGCCGGTGTAGTAG
 
. : . : . : . : . : . :
JMSF037L12+ CGGTCTGCGAGCCACGCCGTGTTGAAGACATCCGTGGAGTTAGTATGACCACCGCAATCT
JMSF027I18+ CGGTCTGCGAGCCACGCCGTGTTGAAGACATCCGTGGAGTTAGTATGACCACCGCAATCT
JMSF045F04+ CGGTCTGCGAGCCACGCCGTGTTGAAGACATCCGTGGAGTTAGTATGACCACCGCAATCT
                      ____________________________________________________________
consensus CGGTCTGCGAGCCACGCCGTGTTGAAGACATCCGTGGAGTTAGTATGACCACCGCAATCT
 
. : . : . : . : . : . :
JMSF037L12+ ATGTGCAAATTGTAAGTGAAAGGGTAGGGCAGAGAATCTGCAGAAAAAGAAAAGAGAGAG
JMSF027I18+ ATGTGCAAATTGTAAGTGAAAGGGTAGGGCAGAGAATCTGCAGAAAAAGAAAAGAGAGAG
JMSF045F04+ ATGTGCAAATTGTAAGTGAAAGGGTAGGGCAGAGAATCTGCAGAAAAAGAAAAGAGAGAG
                      ____________________________________________________________
consensus ATGTGCAAATTGTAAGTGAAAGGGTAGGGCAGAGAATCTGCAGAAAAAGAAAAGAGAGAG
 
. : . : . : . : . : . :
JMSF037L12+ AAGAGAGAAAGGATTAGAAGAGGAGACATGGTAT
JMSF027I18+ AAGAGAGAAAGGATTAGAAGAGGAGACATGGTATGGGAGTAGAGTATTGTCACTGTTGGT
JMSF045F04+ AAGAGAGAAAGGATTAGAAGAGGAGACATGGTATGGGAGTAGAGTATTGTCACTGTTGGT
                      ____________________________________________________________
consensus AAGAGAGAAAGGATTAGAAGAGGAGACATGGTATGGGAGTAGAGTATTGTCACTGTTGGT
 
. : . : . : . : . : . :
JMSF027I18+ TGTTTGGACACATAAGAAGGAAAAAAGCTCCGCCGGTCGCGGCGGGGTAGGTGGCG
JMSF045F04+ TGTTTGGACACATAAGAAGGAAAAAAGCTCCGCCGGTCGCGGCGGGGTAGGTGGCGCGCC
                      ____________________________________________________________
consensus TGTTTGGACACATAAGAAGGAAAAAAGCTCCGCCGGTCGCGGCGGGGTAGGTGGCGCGCC