Previous Contig 007657:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003B24Sequence257007657 (2)741013600 (2)gb:BT002317_16359201e-62Arabidopsis thaliana clone C105095 putative lysyl-tRNA synthetase (At3g13490) mR
JMSF045D19Sequence737007657 (2)gb:BT002317_16359204e-81Arabidopsis thaliana clone C105095 putative lysyl-tRNA synthetase (At3g13490) mR816013600 (2)gb:BT002317_16359209e-66Arabidopsis thaliana clone C105095 putative lysyl-tRNA synthetase (At3g13490) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045D19+ CTCAGGGTTTGCAATCA
                      ____________________________________________________________
consensus CTCAGGGTTTGCAATCA
 
. : . : . : . : . : . :
JMSF045D19+ TATCTATATACCGCTGCCGGTAGCGCTTATCTACATCTGTTAGGCCATGATATTTGTCCG
                      ____________________________________________________________
consensus TATCTATATACCGCTGCCGGTAGCGCTTATCTACATCTGTTAGGCCATGATATTTGTCCG
 
. : . : . : . : . : . :
JMSF045D19+ GCAATGGAAGTAGGGACTTTGTAAGAATTGAAAATGAATTCACACAAACTGATAGCTCCC
                      ____________________________________________________________
consensus GCAATGGAAGTAGGGACTTTGTAAGAATTGAAAATGAATTCACACAAACTGATAGCTCCC
 
. : . : . : . : . : . :
JMSF045D19+ CTTTCTCAGTGCGTTTGATTGAACCACGAGCACCCAAGATATCTCCTATATCAACAAGTG
                      ____________________________________________________________
consensus CTTTCTCAGTGCGTTTGATTGAACCACGAGCACCCAAGATATCTCCTATATCAACAAGTG
 
. : . : . : . : . : . :
JMSF045D19+ TCTTCAAATGGTCAAATTGATCACTGGAGAGCCTTTCCTTCTCACAGTAGAGCTGAATTG
                      ____________________________________________________________
consensus TCTTCAAATGGTCAAATTGATCACTGGAGAGCCTTTCCTTCTCACAGTAGAGCTGAATTG
 
. : . : . : . : . : . :
JMSF045D19+ TCCCAGAGTCATCTCTCAAGGTAAAAAAGGCAAGCTTTCCAAAAGCTCTGCGAGCCACAA
                      ____________________________________________________________
consensus TCCCAGAGTCATCTCTCAAGGTAAAAAAGGCAAGCTTTCCAAAAGCTCTGCGAGCCACAA
 
. : . : . : . : . : . :
JMSF045D19+ TTCTTCCTGATATTGAGACATAATCATTCTCATTGTTTGACTCTTCACCATTTCCTAGAT
                      ____________________________________________________________
consensus TTCTTCCTGATATTGAGACATAATCATTCTCATTGTTTGACTCTTCACCATTTCCTAGAT
 
. : . : . : . : . : . :
JMSF045D19+ CTTTATAAATCTCTTGTAACTGATTAGCCGTATGAGTCCTATCCCACTTGTATGCGTAGG
                      ____________________________________________________________
consensus CTTTATAAATCTCTTGTAACTGATTAGCCGTATGAGTCCTATCCCACTTGTATGCGTAGG
 
. : . : . : . : . : . :
JMSF003B24+ CTTCTTGATGCGGATGGCGCGAATGGCTT
JMSF045D19+ GTTCCAAGCCCTTGATTCTTAATTCTTCCACCTTCTTGATGCGGATGGCGCGAATGGCTT
                      ____________________________________________________________
consensus GTTCCAAGCCCTTGATTCTTAATTCTTCCACCTTCTTGATGCGGATGGCGCGAATGGCTT
 
. : . : . : . : . : . :
JMSF003B24+ CTCTATCGGAGGTGGAGGTGGTAGATGAGGACCGCCGGTTACGGCCGGCGGCTCTGTCAG
JMSF045D19+ CTCTATCGGAGGTGGAGGTGGTAGATGAGGACCGCCGGTTACGGCCGGCGGCTCTGTCAG
                      ____________________________________________________________
consensus CTCTATCGGAGGTGGAGGTGGTAGATGAGGACCGCCGGTTACGGCCGGCGGCTCTGTCAG
 
. : . : . : . : . : . :
JMSF003B24+ TGACGAAGGCGGCGGCAGAAGAAGAAGACGACGAGCAACAGCGAACAATGAAACAAGAAG
JMSF045D19+ TGACGAAGGCGGCGGCAGAAGAAGAAGACGACGAGCAACAGCGAACAATGAAACAAGAAG
                      ____________________________________________________________
consensus TGACGAAGGCGGCGGCAGAAGAAGAAGACGACGAGCAACAGCGAACAATGAAACAAGAAG
 
. : . : . : . : . : . :
JMSF003B24+ AAGGGTTTCGAAATTGAATTGCTCGGGTAGACCTCAAAGAAGCAAAGTGGATGAGGTGCT
JMSF045D19+ AAGGGTTTCGAAATTGAATTGCTCGGGTAGACCTCAAAGAAGCAAAGTGGATGAGGTGCT
                      ____________________________________________________________
consensus AAGGGTTTCGAAATTGAATTGCTCGGGTAGACCTCAAAGAAGCAAAGTGGATGAGGTGCT
 
. : . : . : . : . : . :
JMSF003B24+ TGAATGGGTGTAGCGCCTCCATTCTTCTTCTCTGCTTCGCACTTCACG
JMSF045D19+ TGAATGGGTGTAGCGCCTCCATTCTTCTTCTCTGCTTCGCACTTCACGGCTAGCTCGGCC
                      ____________________________________________________________
consensus TGAATGGGTGTAGCGCCTCCATTCTTCTTCTCTGCTTCGCACTTCACGGCTAGCTCGGCC