Previous Contig 007655:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031P10Sequence626007655 (2)gb:AC005499_15327712e-14Arabidopsis thaliana chromosome 2 clone T6A23 map ve018, complete sequence.>gb:A741012806 (2)
JMSF045D10Sequence698007655 (2)gb:AC005499_15327712e-14Arabidopsis thaliana chromosome 2 clone T6A23 map ve018, complete sequence.>gb:A743012806 (2)gb:AC005499_15327715e-22Arabidopsis thaliana chromosome 2 clone T6A23 map ve018, complete sequence.>gb:A

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031P10+ TTTTCAGCAGCAGCACCCTTACT
JMSF045D10+ TCAGTATCCTTCACTTTTTCAGCAGCAGCACCCTTACT
                      ____________________________________________________________
consensus TCAGTATCCTTCACTTTTTCAGCAGCAGCACCCTTACT
 
. : . : . : . : . : . :
JMSF031P10+ GTGAACCTTGTTGCTATTTTCTTTAGGGTGTTCTTTAGGCATAGCAACTGGCAGCGGAGG
JMSF045D10+ GTGAACCTTGTTGCTATTTTCTTTAGGGTGTTCTTTAGGCATAGCAACTGGCAGCGGAGG
                      ____________________________________________________________
consensus GTGAACCTTGTTGCTATTTTCTTTAGGGTGTTCTTTAGGCATAGCAACTGGCAGCGGAGG
 
. : . : . : . : . : . :
JMSF031P10+ ACCAATAGTAGTCTTGTTCTCAGCTTCCTTTATAATGTTCTTCTGAAAATCCTTTGGAAA
JMSF045D10+ ACCAATAGTAGTCTTGTTCTCAGCTTCCTTTATAATGTTCTTCTGAAAATCCTTTGGAAA
                      ____________________________________________________________
consensus ACCAATAGTAGTCTTGTTCTCAGCTTCCTTTATAATGTTCTTCTGAAAATCCTTTGGAAA
 
. : . : . : . : . : . :
JMSF031P10+ AGTAGGTTCCAATCTTCTTATAACATCATCTATATGACTTGATTGCTCACCCTTCGATTT
JMSF045D10+ AGTAGGTTCCAATCTTCTTATAACATCATCTATATGACTTGATTGCTCACCCTTCGATTT
                      ____________________________________________________________
consensus AGTAGGTTCCAATCTTCTTATAACATCATCTATATGACTTGATTGCTCACCCTTCGATTT
 
. : . : . : . : . : . :
JMSF031P10+ GTTTCTAGATATAGTAGCTTCAGGTTGATCATAAACATGAACCATTTTAGTGAATGAAGT
JMSF045D10+ GTTTCTAGATATAGTAGCTTCAGGTTGATCATAAACATGAACCATTTTAGTGAATGAAGT
                      ____________________________________________________________
consensus GTTTCTAGATATAGTAGCTTCAGGTTGATCATAAACATGAACCATTTTAGTGAATGAAGT
 
. : . : . : . : . : . :
JMSF031P10+ TTGTTTTTCAGTAACATATCCGGGTGAAGGATGGAAGCCATTGTGTAGGCCGAGCAAAAA
JMSF045D10+ TTGTTTTTCAGTAACATATCCGGGTGAAGGATGGAAGCCATTGTGTAGGCCGAGCAAAAA
                      ____________________________________________________________
consensus TTGTTTTTCAGTAACATATCCGGGTGAAGGATGGAAGCCATTGTGTAGGCCGAGCAAAAA
 
. : . : . : . : . : . :
JMSF031P10+ GATAAGAGGCACGAGCATGGAAAGAAACACGAGACAGAGAACAGCAATCACCAGGAAATT
JMSF045D10+ GATAAGAGGCACGAGCATGGAAAGAAACACGAGACAGAGAACAGCAATCACCAGGAAATT
                      ____________________________________________________________
consensus GATAAGAGGCACGAGCATGGAAAGAAACACGAGACAGAGAACAGCAATCACCAGGAAATT
 
. : . : . : . : . : . :
JMSF031P10+ CCACCGCCTCTTCCCCGGCGGAATAGCGTAAGGCGGTCCACCGCCCTTCATCTCCTCCTC
JMSF045D10+ CCACCGCCTCTTCCCCGGCGGAATAGCGTAAGGCGGTCCACCGCCCTTCATCTCCTCCTC
                      ____________________________________________________________
consensus CCACCGCCTCTTCCCCGGCGGAATAGCGTAAGGCGGTCCACCGCCCTTCATCTCCTCCTC
 
. : . : . : . : . : . :
JMSF031P10+ CTCCTGGCACTCGCTCCCAGCGCCTTATCACTGTCCCCTAATGACCTTTAATATCTCCTT
JMSF045D10+ CTCCTGGCACTCGCTCCCAGCGCCTTATCACTGTCCCCTAATGACCTTTAATATCTCCTT
                      ____________________________________________________________
consensus CTCCTGGCACTCGCTCCCAGCGCCTTATCACTGTCCCCTAATGACCTTTAATATCTCCTT
 
. : . : . : . : . : . :
JMSF031P10+ CACGGCCAAATCTAACAGGCATTGAAGGATCACGTCACCTGGAATCCAGCCGGAAAGTTG
JMSF045D10+ CACGGCCAAATCTAACAGGCATTGAAGGATCACGTCACCTGGAATCCAGCCGGAAAGTTG
                      ____________________________________________________________
consensus CACGGCCAAATCTAACAGGCATTGAAGGATCACGTCACCTGGAATCCAGCCGGAAAGTTG
 
. : . : . : . : . : . :
JMSF031P10+ CCCTCTATGAACTGATGTGGATTTAGCACTAGGCGGTGTCGCCGTCGAGTGGAATCAAAC
JMSF045D10+ CCCTCTATGAACTGATGTGGATTTAGCACTAGGCGGTGTCGCCGTCGAGTGGAATCAAAC
                      ____________________________________________________________
consensus CCCTCTATGAACTGATGTGGATTTAGCACTAGGCGGTGTCGCCGTCGAGTGGAATCAAAC
 
. : . : . : . : . : . :
JMSF031P10+ AC
JMSF045D10+ ACGGAATGTTGTAATACGCCAACTGGGAGATTAGCGAGAGGAGGGAACCGTGATGCCATC
                      ____________________________________________________________
consensus ACGGAATGTTGTAATACGCCAACTGGGAGATTAGCGAGAGGAGGGAACCGTGATGCCATC