Previous Contig 007652:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012N03Sequence473007652 (5)706007652 (5)
JMSF013H18Sequence502007652 (5)690007652 (5)
JMSF045C08Sequence721007652 (5)671024140

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013H18- AAATTACATTTTCAATCACTACTGGGTTGAAGAGGAAGCATCTAAGCCAAAA
rJMSF012N03- GACGAAAATTACATTTTCAATCACTACTGGGTTGAAGAGGAAGCATCTAAGCCAAAA
                      ____________________________________________________________
consensus GACGAAAATTACATTTTCAATCACTACTGGGTTGAAGAGGAAGCATCTAAGCCAAAA
 
. : . : . : . : . : . :
rJMSF013H18- CAAAGGTAAATCTATCTACTAATATGATTATTACACCACTAATGCTTGAAATCACTCTTA
rJMSF012N03- CAAAGGTAAATCTATCTACTAATATGATTATTACACCACTAATGCTTGAAATCACTCTTA
                      ____________________________________________________________
consensus CAAAGGTAAATCTATCTACTAATATGATTATTACACCACTAATGCTTGAAATCACTCTTA
 
. : . : . : . : . : . :
rJMSF013H18- GATATATAGCCATATTAGCATGAAAAACAGTCTGGATTTAAAACAATTTCAAAATTTCCA
rJMSF012N03- GATATATAGCCATATTAGCATGAAAAACAGTCTGGATTTAAAACAATTTCAAAATTTCCA
                      ____________________________________________________________
consensus GATATATAGCCATATTAGCATGAAAAACAGTCTGGATTTAAAACAATTTCAAAATTTCCA
 
. : . : . : . : . : . :
rJMSF013H18- GAAAACAGAGGAATAAGATTGGAAAAACTTATCTCTGTAGCAAATCGCATCACTTTTTCT
rJMSF012N03- GAAAACAGAGGAATAAGATTGGAAAAACTTATCTCTGTAGCAAATCGCATCACTTTTTCT
                      ____________________________________________________________
consensus GAAAACAGAGGAATAAGATTGGAAAAACTTATCTCTGTAGCAAATCGCATCACTTTTTCT
 
. : . : . : . : . : . :
rJMSF013H18- GGATCCCAACATAGTCCTGACATATATTAACACAAGACTAGACGTCGTTGTTAAATATAA
rJMSF012N03- GGATCCCAACATAGTCCTGACATATATTAACACAAGACTAGACGTCGTTGTTAAATATAA
JMSF045C08+ A
                      ____________________________________________________________
consensus GGATCCCAACATAGTCCTGACATATATTAACACAAGACTAGACGTCGTTGTTAAATATAA
 
. : . : . : . : . : . :
rJMSF013H18- AGTCTGTTTTTAAAATAAATATGAAAATAACATATTGAAAGAAAAAATTAAAAACAAAAA
rJMSF012N03- AGTCTGTTTTTAAAATAAATATGAAAATAACATATTGAAAGAAAAAATTAAAAACAAAAA
JMSF045C08+ AGTCTGTTTTTAAAATAAATATGAAAATAACATNTTGAAAGAAAAAATTAAAAACAAAAA
                      ____________________________________________________________
consensus AGTCTGTTTTTAAAATAAATATGAAAATAACATATTGAAAGAAAAAATTAAAAACAAAAA
 
. : . : . : . : . : . :
rJMSF013H18- GAAACTTCGCAACCGCGAGTCCACTAAGCTAATGCAGATACTAACATTAGAATACAATTT
rJMSF012N03- GAAACTTCGCAACCGCGAGTCCACTAAGCTAATGCAGATACTAACATTAGAATACAATTT
JMSF045C08+ GAAACTTCGCAACCGCGAGTCCACTAAGCTAATGCAGATACTAACATTAGAATACAATTT
                      ____________________________________________________________
consensus GAAACTTCGCAACCGCGAGTCCACTAAGCTAATGCAGATACTAACATTAGAATACAATTT
 
. : . : . : . : . : . :
rJMSF013H18- TTTTTTTTCAAAATCCAGANGCANGNGTTTTCCAANGAANGATTTCATCAGATCTACNCT
rJMSF012N03- TTTTTTTTCAAAATCCAGATGCANGNGTTTTCCAANGAANGATTTCATCAGATCTACNCT
JMSF045C08+ TTTTTTTTCAAAATCCAGATGCATGTGTTTTCCAATGAATGATTTCATCAGATCTACACT
                      ____________________________________________________________
consensus TTTTTTTTCAAAATCCAGATGCATGTGTTTTCCAATGAATGATTTCATCAGATCTACACT
 
. : . : . : . : . : . :
rJMSF013H18- TTAATTGGACTTAGTAGTTAAACGAACCCTTAACNGTTAGGGTTCACCGTATCAGTTAAN
rJMSF012N03- TTAATTGGACTTAGTAGTTAAACGAACCCTTAACNGTTAGGGTTCACCGTATCAGTTAAN
JMSF013H18+ GACTTAGTAGTTAAACGAACCCTTAACTGTTAGGGTTCACCGTATCAGTTAAA
JMSF045C08+ TTAATTGGACTTAGTAGTTAAACGAACCCTTAACTGTTAGGGTTCACCGTATCAGTTAAA
                      ____________________________________________________________
consensus TTAATTGGACTTAGTAGTTAAACGAACCCTTAACTGTTAGGGTTCACCGTATCAGTTAAA
 
. : . : . : . : . : . :
rJMSF013H18- CAACATAGATGGATAAATCCTAAATATATCATACTTAGATCTGAAACAGTAAAGATGTTA
rJMSF012N03- CANCATAGATGGATAAATCCTAAATATATCATACTTAGATCTGAAACAGTAAAGATGTTA
JMSF013H18+ CAACATAGATAGATAAATCCTAAATATATCATACTTAGATCTGAAACAGTAAAGATGTTA
JMSF012N03+ ACATAGATAGATAAATCCTAAATATATCATACTTAGATCTGAAACAGTAAAGATGTTA
JMSF045C08+ CAACATAGATAGATAAATCCTAAATATATCATACTTAGATCTGAAACAGTAAAGATGTTA
                      ____________________________________________________________
consensus CAACATAGATAGATAAATCCTAAATATATCATACTTAGATCTGAAACAGTAAAGATGTTA
 
. : . : . : . : . : . :
rJMSF013H18- CGGTTAGAAATCCTCNCCGAATTAGGTAGAAATTGTCAACTAATCTGTAAGCAACCGNGT
rJMSF012N03- CGGTTAGAAATCCTCACCGAATTAGGTAGAAATTGTCAACTAATCTGTAAGCAACCGNGT
JMSF013H18+ CGGTTAGAAATCCTCACCGAATTAGGTAGAAATTGTCAACTAATCTGTAAGCANCCGTGT
JMSF012N03+ CGGTTAGAAATCCTCACCGAATTAGGTAGAAATTGTCAACTAATCTGTAAGCANCCGTGT
JMSF045C08+ CGGTTAGAAATCCTCACCGAATTAGGTAGAAATTGTCAACTAATCTGTAAGCAACCGTGT
                      ____________________________________________________________
consensus CGGTTAGAAATCCTCACCGAATTAGGTAGAAATTGTCAACTAATCTGTAAGCAACCGTGT
 
. : . : . : . : . : . :
rJMSF013H18- AGATTTGCNCAAATTTAACATGCNCTTCNCCTGACC
rJMSF012N03- AGATTTGCNCAAATTTAACATGCNCTTCACCTGACCTGTATAATCATAG
JMSF013H18+ AGATTTGCACAAATTTAACATGCACTTCACCTGACCTGTATAATCATAGTTAAGCTCCGA
JMSF012N03+ AGATTTGCACAAATTTAACATGCACTTCACCTGACCTGTATAATCATAGTTAAGCTCCGA
JMSF045C08+ AGATTTGCACAAATTTAACATGCACTTCACCTGACCTGTATAATCATAGTTAAGCTCCGA
                      ____________________________________________________________
consensus AGATTTGCACAAATTTAACATGCACTTCACCTGACCTGTATAATCATAGTTAAGCTCCGA
 
. : . : . : . : . : . :
JMSF013H18+ TCTCTCTCTACGGTCGTATTCCGACGAAGGATAATGTTCACTGGTTTTGACACATATGAC
JMSF012N03+ TCTCTCTCTACGGTCGTATTCCGACGAAGGATAATGTTCACTGGTTTTGACACATATGAC
JMSF045C08+ TCTCTCTCTACGGTCGTATTCCGACGAAGGATAATGTTCACTGGTTTTGACACATATGAC
                      ____________________________________________________________
consensus TCTCTCTCTACGGTCGTATTCCGACGAAGGATAATGTTCACTGGTTTTGACACATATGAC
 
. : . : . : . : . : . :
JMSF013H18+ ATAAAATCGGTGAAGACTGGAAACCTACGGGAAATATGGATTTAACACTCAGAGACGAAG
JMSF012N03+ ATAAAATCGGTGAAGACTGGAAACCTACGGGAAATATGGATTTAACACTCAGAGACGAAG
JMSF045C08+ ATAAAATCGGTGAAGACTGGAAACCTACGGGAAATATGGATTTAACACTCAGAGACGAAG
                      ____________________________________________________________
consensus ATAAAATCGGTGAAGACTGGAAACCTACGGGAAATATGGATTTAACACTCAGAGACGAAG
 
. : . : . : . : . : . :
JMSF013H18+ TATTTCTATAACGATCGGCGATTTTTATAGTGAAACAAAATCATCTTCATCGTGAACCAT
JMSF012N03+ TATTTCTATAACGATCGGCGATTTTTATAGTGAAACAAAATCATCTTCATCGTGAACCAT
JMSF045C08+ TATTTCTATAACGATCGGCGATTTTTATAGTGAAACAAAATCATCTTCATCGTGAACCAT
                      ____________________________________________________________
consensus TATTTCTATAACGATCGGCGATTTTTATAGTGAAACAAAATCATCTTCATCGTGAACCAT
 
. : . : . : . : . : . :
JMSF013H18+ TGGATAGAGAGAGAGAGAGAGAGAGAGAACTGAGAAAATGATAAGCCGGAGGAAGCACCC
JMSF012N03+ TGGATAGAGAGAGAGAGAGAGAGAGAGAACTGAGAAAATGATAAGCCGGAGGAAGCACCC
JMSF045C08+ TGGATAGAGAGAGAGAGAGAGAGAGAGAACTGAGAAAATGATAAGCCGGAGGAAGCACCC
                      ____________________________________________________________
consensus TGGATAGAGAGAGAGAGAGAGAGAGAGAACTGAGAAAATGATAAGCCGGAGGAAGCACCC
 
. : . : . : . : . : . :
JMSF013H18+ TCCACTTTTAGAGAGGGAGAGAACTGCT
JMSF012N03+ TCCACTTTTAGAGAGGGAGAGAACTGCTGAAATGAGATTGACCGGACAGGCCA
JMSF045C08+ TCCACTTTTAGAGAGGGAGAGAACTGCTGAAATGAGATTGACCGGACAGGCCACAAGATC
                      ____________________________________________________________
consensus TCCACTTTTAGAGAGGGAGAGAACTGCTGAAATGAGATTGACCGGACAGGCCACAAGATC