Previous Contig 007648:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029P11Sequence526007648 (5)gb:AY063895_15658426e-39Arabidopsis thaliana putative proline-rich protein (At4g28300) mRNA, complete cd676013587 (5)gb:AY063895_15658421e-14Arabidopsis thaliana putative proline-rich protein (At4g28300) mRNA, complete cd
JMSF007I13Sequence413007648 (5)gb:AY063895_15658423e-25Arabidopsis thaliana putative proline-rich protein (At4g28300) mRNA, complete cd725013587 (5)gb:AP003268_18268019e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P050
JMSF016K22Sequence238007648 (5)gb:AY063895_15658426e-19Arabidopsis thaliana putative proline-rich protein (At4g28300) mRNA, complete cd748013587 (5)gb:AY063895_15658421e-14Arabidopsis thaliana putative proline-rich protein (At4g28300) mRNA, complete cd
JMSF034G04Sequence692007648 (5)gb:AY063895_15658422e-47Arabidopsis thaliana putative proline-rich protein (At4g28300) mRNA, complete cd739013587 (5)gb:AY063895_15658423e-16Arabidopsis thaliana putative proline-rich protein (At4g28300) mRNA, complete cd
JMSF045B07Sequence673007648 (5)gb:AY063895_15658424e-60Arabidopsis thaliana putative proline-rich protein (At4g28300) mRNA, complete cd647013587 (5)gb:AY063895_15658421e-14Arabidopsis thaliana putative proline-rich protein (At4g28300) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034G04+ AGAAAAAGAAAATTA
                      ____________________________________________________________
consensus AGAAAAAGAAAATTA
 
. : . : . : . : . : . :
JMSF034G04+ TCATTATCTTACACTTTTACAGTTTAAAAAGGGCTGTGATATTTTCAAACTTCAACTCCA
                      ____________________________________________________________
consensus TCATTATCTTACACTTTTACAGTTTAAAAAGGGCTGTGATATTTTCAAACTTCAACTCCA
 
. : . : . : . : . : . :
JMSF034G04+ TCGAAAAGCATGCCAACAAATATAGAGCATTATGAAGTATATTTCAAAATCTGCTTCAGA
                      ____________________________________________________________
consensus TCGAAAAGCATGCCAACAAATATAGAGCATTATGAAGTATATTTCAAAATCTGCTTCAGA
 
. : . : . : . : . : . :
JMSF034G04+ GAGGAATAGATGAGATACAGCAGTTATATCACAGAAGAGTAAGATAACTTGTGCTATGAT
                      ____________________________________________________________
consensus GAGGAATAGATGAGATACAGCAGTTATATCACAGAAGAGTAAGATAACTTGTGCTATGAT
 
. : . : . : . : . : . :
JMSF034G04+ AAATATAGATATGTACCTCTTGGAGATTCTTCTCAAGAGACTTGAGCTTGGTATCTGCCT
JMSF045B07+ ACCTCTTGGAGATTCTTCTCAAGAGACTTGAGCTTGGTATCTGCCT
                      ____________________________________________________________
consensus AAATATAGATATGTACCTCTTGGAGATTCTTCTCAAGAGACTTGAGCTTGGTATCTGCCT
 
. : . : . : . : . : . :
JMSF034G04+ CTCCATGATCCCGTACCAAATCAGAATGCATTTCTCCTATGGATTTATCAAGATTGTAAC
JMFF029P11+ TTCTCCTATGGATTTATCAAGATTGTAAC
JMSF045B07+ CTCCATGATCCCGTACCAAATCAGAATGCATTTCTCCTATGGATTTATCAAGATTGTAAC
                      ____________________________________________________________
consensus CTCCATGATCCCGTACCAAATCAGAATGCATTTCTCCTATGGATTTATCAAGATTGTAAC
 
. : . : . : . : . : . :
JMSF034G04+ AATATAATTCCAGCTGAGACAGCCGTGAACTTATTCCCTCAAGGAAACGCATCAGATTGT
JMFF029P11+ AATATAATTCCAGCTGAGACAGCCGTGAACTTATTCCCTCAAGGAAACGCATCAGATTGT
JMSF007I13+ CAAGGAAACGCATCAGATTGT
JMSF045B07+ AATATAATTCCAGCTGAGACAGCCGTGAACTTATTCCCTCAAGGAAACGCATCAGATTGT
                      ____________________________________________________________
consensus AATATAATTCCAGCTGAGACAGCCGTGAACTTATTCCCTCAAGGAAACGCATCAGATTGT
 
. : . : . : . : . : . :
JMSF034G04+ CAGCATATTTCTTCACAGTCTTCTCAACAATAGCACCAACATCTTGATGAACTGAAGATT
JMFF029P11+ CAGCATATTTCTTCACAGTCTTCTCAACAATAGCACCAACATCTTGATGAACTGAAGATT
JMSF007I13+ CAGCATATTTCTTCACAGTCTTCTCAACAATAGCACCAACATCTTGATGAACTGAAGATT
JMSF045B07+ CAGCATATTTCTTCACAGTCTTCTCAACAATAGCACCAACATCTTGATGAACTGAAGATT
                      ____________________________________________________________
consensus CAGCATATTTCTTCACAGTCTTCTCAACAATAGCACCAACATCTTGATGAACTGAAGATT
 
. : . : . : . : . : . :
JMSF034G04+ CCTCAGGCGGACTATAAGCAGGAGCAGGAAACATAGCTGTTCTTGTCATTCTGTTTTTGT
JMSF016K22+ AGGAGCAGGAAACATAGCTGTTCTTGTCATTCTGTTTTTGT
JMFF029P11+ CCTCAGGCGGACTATAAGCAGGAGCAGGAAACATAGCTGTTCTTGTCATTCTGTTTTTGT
JMSF007I13+ CCTCAGGCGGACTATAAGCAGGAGCAGGAAACATAGCTGTTCTTGTCATTCTGTTTTTGT
JMSF045B07+ CCTCAGGCGGACTATAAGCAGGAGCAGGAAACATAGCTGTTCTTGTCATTCTGTTTTTGT
                      ____________________________________________________________
consensus CCTCAGGCGGACTATAAGCAGGAGCAGGAAACATAGCTGTTCTTGTCATTCTGTTTTTGT
 
. : . : . : . : . : . :
JMSF034G04+ GAAATTCCTTTGCGGAGTTGGAAGCAGTCACTGGATCAGAGTGATTTCCATTAGTGTTGT
JMSF016K22+ GAAATTCCTTTGCGGAGTTGGAAGCAGTCACTGGATCAGAGTGATTTCCATTAGTGTTGT
JMFF029P11+ GAAATTCCTTTGCGGAGTTGGAAGCAGTCACTGGATCAGAGTGATTTCCATTAGTGTTGT
JMSF007I13+ GAAATTCCTTTGCGGAGTTGGAAGCAGTCACTGGATCAGAGTGATTTCCATTAGTGTTGT
JMSF045B07+ GAAATTCCTTTGCGGAGTTGGAAGCAGTCACTGGATCAGAGTGATTTCCATTAGTGTTGT
                      ____________________________________________________________
consensus GAAATTCCTTTGCGGAGTTGGAAGCAGTCACTGGATCAGAGTGATTTCCATTAGTGTTGT
 
. : . : . : . : . : . :
JMSF034G04+ CCTGATTGGCAAAGTCATCGTAGGAGCAAAGAATATCATCTGACGCGAAATCAAAGGCTT
JMSF016K22+ CCTGATTGGCAAAGCCATCGTAGGAGCAAAGAATATCATCTGACGCGAAATCAAAGGCTT
JMFF029P11+ CCTGATTGGCAAAGCCATCGTAGGAGCAAAGAATATCATCTGACGCGAAATCAAAGGCTT
JMSF007I13+ CCTGATTGGCAAAGTCATCGTAGGAGCAAAGAATATCATCTGACGCGAAATCAAAGGCTT
JMSF045B07+ CCTGATTGGCAAAGTCATCGTAGGAGCAAAGAATATCATCTGACGCGAAATCAAAGGCTT
                      ____________________________________________________________
consensus CCTGATTGGCAAAGTCATCGTAGGAGCAAAGAATATCATCTGACGCGAAATCAAAGGCTT
 
. : . : . : . : . : . :
JMSF034G04+ TAGAACCCGGATTGTTGGCCCGACTCGATGATCCGGAAGCCATGACACACAAATCGAGAA
JMSF016K22+ TAGAACCCGGATTGTTGGCCCGACTCGATGATCCGGAAGCCATGACACACAAATCGAGAA
JMFF029P11+ TAGAACCCGGATTGTTGGCCCGACTCGATGATCCGGAAGCCATGACACACAAATCGAGAA
JMSF007I13+ TAGAACCCGGATTGTTGGCCCGACTCGATGATCCGGAAGCCATGACACACAAATCGAGAA
JMSF045B07+ TAGAACCCGGATTGTTGGCCCGACTCGATGATCCGGAAGCCATGACACACAAATCGAGAA
                      ____________________________________________________________
consensus TAGAACCCGGATTGTTGGCCCGACTCGATGATCCGGAAGCCATGACACACAAATCGAGAA
 
. : . : . : . : . : . :
JMSF034G04+ GCAATTAGGGGTTTA
JMSF016K22+ GCAATTAGGGGTTTA
JMFF029P11+ GCAATTAGGGGTTTATGGAGATTGCAATTGCGAGTACTTCCAGATACAAAAAGTGGAGAG
JMSF007I13+ GCAATTAGGGGTTTATGGAGATTGCAATTGCGAGTACTTCCAGATATAAAAAGTGGAGAG
JMSF045B07+ GCAATTAGGGGTTTATGGAGATTGCAATTGCGAGTACTTCCAGATATAAAAAGTGGAGAG
                      ____________________________________________________________
consensus GCAATTAGGGGTTTATGGAGATTGCAATTGCGAGTACTTCCAGATATAAAAAGTGGAGAG
 
. : . : . : . : . : . :
JMFF029P11+ AGAGAGCGATCGTACGGACTATTTTTGCTTTAGCTAAACTTCTTCGCATACC
JMSF007I13+ AGAGAGCGATCGTACGGACTATTTTTGCTTT
JMSF045B07+ AGAGAGCGATCGTACGGACTATTTTTGCTTTAGCTAAACTTCTTCGCATACCAATTGCCC
                      ____________________________________________________________
consensus AGAGAGCGATCGTACGGACTATTTTTGCTTTAGCTAAACTTCTTCGCATACCAATTGCCC