Previous Contig 007646:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF045A21Sequence694007646 (2)pir|T25031|T250310.039hypothetical protein T20D3.3 - Caenorhabditis elegans770024130
JMSF046A21Sequence688007646 (2)pir|T25031|T250310.039hypothetical protein T20D3.3 - Caenorhabditis elegans674024191

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046A21+ ATTTGAGAATTTTTTCAACCCTATATAT
JMSF045A21+ TTCTNTAATTTGAGAA-TTTTTCAACCCTATATAT
                      ____________________________________________________________
consensus TTCTNTAATTTGAGAATTTTTTCAACCCTATATAT
 
. : . : . : . : . : . :
JMSF046A21+ ATAGTGATAGCACAAAAAAGCAAAAAGGAAGCAGAACAAAGAGAGAGAGCTGCCATAAAA
JMSF045A21+ ATAGTGATAGCACAAAAAAGCAAAAAGGAAGCAGAACAAAGAGAGAGAGCTGCCATAAAA
                      ____________________________________________________________
consensus ATAGTGATAGCACAAAAAAGCAAAAAGGAAGCAGAACAAAGAGAGAGAGCTGCCATAAAA
 
. : . : . : . : . : . :
JMSF046A21+ GGCAGTNTGAGTTGTGATTGCATTGTATACTTGCCACAACAAATAAACAAAACAAAATGA
JMSF045A21+ GGCAGTNTGAGTTGTGATTGCATTGTATACTTGCCACAACAAATAAACAAAACAAAATGA
                      ____________________________________________________________
consensus GGCAGTNTGAGTTGTGATTGCATTGTATACTTGCCACAACAAATAAACAAAACAAAATGA
 
. : . : . : . : . : . :
JMSF046A21+ TACAAAACCCAGTTTTAGTCTATTGAGGAACTCCTTGAAAACACCAAAGGAATCTAAGAA
JMSF045A21+ TACAAAACCCAGTTTTAGTCTATTGAGGAACTCCTTGAAAACACCAAAGGAATCTAAGAA
                      ____________________________________________________________
consensus TACAAAACCCAGTTTTAGTCTATTGAGGAACTCCTTGAAAACACCAAAGGAATCTAAGAA
 
. : . : . : . : . : . :
JMSF046A21+ TAAGTGGAAAATCACAACAAAGTAGCAGACAATTTCGTTGAAATATTGGGGGAAAATAAC
JMSF045A21+ TAAGTGGAAAATCACAACAAAGTAGCAGACAATTTCGTTGAAATATTGGGGGAAAATAAC
                      ____________________________________________________________
consensus TAAGTGGAAAATCACAACAAAGTAGCAGACAATTTCGTTGAAATATTGGGGGAAAATAAC
 
. : . : . : . : . : . :
JMSF046A21+ TGGAATATTCAATCCAATTTGTAGCATAATCAGCTAGAAGTTTATCAAAATTATAATCCA
JMSF045A21+ TGGAATATTCAATCCAATTTGTAGCATAATCAGCTAGAAGTTTATCAAAATTATAATCCA
                      ____________________________________________________________
consensus TGGAATATTCAATCCAATTTGTAGCATAATCAGCTAGAAGTTTATCAAAATTATAATCCA
 
. : . : . : . : . : . :
JMSF046A21+ CAAATTCATTCAATCATTAGCTTTATACGATTAACAAAATTGGATTTTGCACAGCCTGTT
JMSF045A21+ CAAATTCATTCAATCATTAGCTTTATACGATTAACAAAATTGGATTTTGCACAGCCTGTT
                      ____________________________________________________________
consensus CAAATTCATTCAATCATTAGCTTTATACGATTAACAAAATTGGATTTTGCACAGCCTGTT
 
. : . : . : . : . : . :
JMSF046A21+ AATGATGGCATCTTGAATAAGTCCCTCATCAGGAGATCGGATAGAGGAAACAGCATGCCA
JMSF045A21+ AATGATGGCATCTTGAATAAGTCCCTCATCAGGAGATCGGATAGAGGAAACAGCATGCCA
                      ____________________________________________________________
consensus AATGATGGCATCTTGAATAAGTCCCTCATCAGGAGATCGGATAGAGGAAACAGCATGCCA
 
. : . : . : . : . : . :
JMSF046A21+ AATTCAATTCAGAAGAAGGGGGGATCACCAAAAAATTAGCAGAAAAGCAGATTAAATTCC
JMSF045A21+ AATTCAATTCAGAAGAAGGGGGGATCACCAAAAAATTAGCAGAAAAGCAGATTAAATTCC
                      ____________________________________________________________
consensus AATTCAATTCAGAAGAAGGGGGGATCACCAAAAAATTAGCAGAAAAGCAGATTAAATTCC
 
. : . : . : . : . : . :
JMSF046A21+ CAGATTTTGGGTTCAAAAAAAATTTGGACCATTTCTCGATTTGTGCGTGTCATCCTTGCG
JMSF045A21+ CAGATTTTGGGTTCAAAAAAAATTTGGACCATTTCTCGATTTGTGCGTGTCATCCTTGCG
                      ____________________________________________________________
consensus CAGATTTTGGGTTCAAAAAAAATTTGGACCATTTCTCGATTTGTGCGTGTCATCCTTGCG
 
. : . : . : . : . : . :
JMSF046A21+ CAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTATCGGATGTCCCCGAAGG
JMSF045A21+ CAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTATCGGATGTCCCCGAAGGGAC
                      ____________________________________________________________
consensus CAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTATCGGATGTCCCCGAAGGGAC
 
. : . : . : . : . : . :
JMSF045A21+ GTTCTTGTTCTTCAATGGCGAACTATATGTACTGGAAGATAGCTGGTTCATCGCCCGACC
                      ____________________________________________________________
consensus GTTCTTGTTCTTCAATGGCGAACTATATGTACTGGAAGATAGCTGGTTCATCGCCCGACC