Previous Contig 007645:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034J02Sequence627007645 (3)gb:AY074384_15675388e-69Arabidopsis thaliana unknown protein (At5g58740) mRNA, complete cds.>gb:AY117251
JMFN046L13Sequence613007645 (3)gb:AY074384_15675383e-74Arabidopsis thaliana unknown protein (At5g58740) mRNA, complete cds.>gb:AY117251
JMSF045A20Sequence772007645 (3)gb:AY074384_15675386e-79Arabidopsis thaliana unknown protein (At5g58740) mRNA, complete cds.>gb:AY117251

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045A20+ GTTTACCTAACAATTGCACAAATCCAGTTTTGACATGACATCCACTAGAGAC
                      ____________________________________________________________
consensus GTTTACCTAACAATTGCACAAATCCAGTTTTGACATGACATCCACTAGAGAC
 
. : . : . : . : . : . :
JMSF045A20+ TGCAGTAAGCCGAGACTCAGAGATGAATCAGAGTGAAGATACATTACTTTCAAAGTTAAG
                      ____________________________________________________________
consensus TGCAGTAAGCCGAGACTCAGAGATGAATCAGAGTGAAGATACATTACTTTCAAAGTTAAG
 
. : . : . : . : . : . :
JMFN034J02+ TGGATCAGGGCAATTGCCATTGAACTGTGCTT
JMFN046L13+ TGGATCAGGGCAATTGCCATTGAACTGTGCTT
JMSF045A20+ TAGATCGGATCCCACCCATGAAGGACTTTGGATCAGGGCAATTGCCATTGAACTGTGCTT
                      ____________________________________________________________
consensus TAGATCGGATCCCACCCATGAAGGACTTTGGATCAGGGCAATTGCCATTGAACTGTGCTT
 
. : . : . : . : . : . :
JMFN034J02+ G-GAAAAATCAAAGCCAGGATTCTCTTCTTGGAACCTTNGAAGCATGAGGCGCTTCTGTT
JMFN046L13+ GTGAAAAATCAAAGCCAGGATTCTCTTCTTGGAACCTTTGAAGCATGAGGCGCTTCTGTT
JMSF045A20+ GTGAAAAATCAAAGCCAGGATTCTCTTCTTGGAACCTTTGAAGCATGAGGCGCTTCTGTT
                      ____________________________________________________________
consensus GTGAAAAATCAAAGCCAGGATTCTCTTCTTGGAACCTTTGAAGCATGAGGCGCTTCTGTT
 
. : . : . : . : . : . :
JMFN034J02+ CAAGGTCTGTGGTGTATGGATCCAACTGACCTTGACCCATGATAGGAGAAGACCATGTCT
JMFN046L13+ CAAGGTCTGTGGTGTATGGATCCAACTGACCTTGACCCATGATAGGAGAAGACCATGTCT
JMSF045A20+ CAAGGTCTGTGGTGTATGGATCCAACTGACCTTGACCCATGATAGGAGAAGACCATGTCT
                      ____________________________________________________________
consensus CAAGGTCTGTGGTGTATGGATCCAACTGACCTTGACCCATGATAGGAGAAGACCATGTCT
 
. : . : . : . : . : . :
JMFN034J02+ GACCTTTATCCCTCTTCTGAAGGGTTACGTGCAGTATATCATCCTCTAAAGTCCAGAATG
JMFN046L13+ GACCTTTATCCCTCTTCTGAAGGGTTACGTGCAGTATATCATCCTCTAAAGTCCAGAATG
JMSF045A20+ GACCTTTATCCCTCTTCTGAAGGGTTACGTGCAGTATATCATCCTCTAAAGTCCAGAATG
                      ____________________________________________________________
consensus GACCTTTATCCCTCTTCTGAAGGGTTACGTGCAGTATATCATCCTCTAAAGTCCAGAATG
 
. : . : . : . : . : . :
JMFN034J02+ AGCAGTCTGTCTTCACATGATTGGTAAGGTCATGATTGAGGTAAGGAGGGTTGCCTTTAA
JMFN046L13+ AGCAGTCTGTCTTCACATGATTGGTAAGGTCATGATTGAGGTAAGGAGGGTTGCCTTTAA
JMSF045A20+ AGCAGTCTGTCTTCACATGATTGGTAAGGTCATGATTGAGGTAAGGAGGGTTGCCTTTAA
                      ____________________________________________________________
consensus AGCAGTCTGTCTTCACATGATTGGTAAGGTCATGATTGAGGTAAGGAGGGTTGCCTTTAA
 
. : . : . : . : . : . :
JMFN034J02+ TCCCAACTTCCAAATGTTTGGACTCGATTTTACAATAGAATAGCTTTTTGGGAACATTTT
JMFN046L13+ TCCCAACTTCCAAATGTTTGGACTCGATTTTACAATAGAATAGCTTTTTGGGAACATTTT
JMSF045A20+ TCCCAACTTCCAAATGTTTGGACTCGATTTTACAATAGAATAGCTTTTTGGGAACATTTT
                      ____________________________________________________________
consensus TCCCAACTTCCAAATGTTTGGACTCGATTTTACAATAGAATAGCTTTTTGGGAACATTTT
 
. : . : . : . : . : . :
JMFN034J02+ CCGGGAGATTGATATAAATATTCAACTCTTCAAGCGTTTGGTCCCATTCAAAGACCTTCT
JMFN046L13+ CCGGGAGATTGATATAAATATTCAACTCTTCAAGCGTTTGGTCCCATTCAAAGACCTTCT
JMSF045A20+ CCGGGAGATTGATATAAATATTCAACTCTTCAAGCGTTTGGTCCCATTCAAAGACCTTCT
                      ____________________________________________________________
consensus CCGGGAGATTGATATAAATATTCAACTCTTCAAGCGTTTGGTCCCATTCAAAGACCTTCT
 
. : . : . : . : . : . :
JMFN034J02+ GACCATTGTGGATGAAGCTATGGTGCTTCTCAGGGGCCAATTTTTCAGCCATTTCTTGAA
JMFN046L13+ GACCATTGTGGATGAAGCTATGGTGCTTCTCAGGGGCCAATTTTTCAGCCATTTCTTGAA
JMSF045A20+ GACCATTGTGGATGAAGCTATGGTGCTTCTCAGGGGCCAATTTTTCAGCCATTTCTTGAA
                      ____________________________________________________________
consensus GACCATTGTGGATGAAGCTATGGTGCTTCTCAGGGGCCAATTTTTCAGCCATTTCTTGAA
 
. : . : . : . : . : . :
JMFN034J02+ GGTCTGGAGCTTTAATCTTACAATTTTCCTATTTCCCAGGATAGTTTGATTCCAATGTCT
JMFN046L13+ GGTCTGGAGCTTTAATCTTACAATTTTCCTATTTCCCAGGATAGTTTGATTCCAATGTCT
JMSF045A20+ GGTCTGGAGCTTTAATCTTACAATTTTCCTATTTCCCAGGATAGTTTGATTCCAATGTCT
                      ____________________________________________________________
consensus GGTCTGGAGCTTTAATCTTACAATTTTCCTATTTCCCAGGATAGTTTGATTCCAATGTCT
 
. : . : . : . : . : . :
JMFN034J02+ TCGTCTGTTCGCAGAGGCTTCGATGCGGCGGAGCAGGCAGCCGGCGGCCGATCTCGGGTG
JMFN046L13+ TCGTCTGTTCGCAGAGGCTTCGATGCGGCGGAGCAGGCAGCCGGCGGCCGATCTCGGGTG
JMSF045A20+ TCGTCTGTTCGCAGAGGCTTCGATGCGGCGGAGCAGGCAGCCGGCGGCCGATCTCGGGTG
                      ____________________________________________________________
consensus TCGTCTGTTCGCAGAGGCTTCGATGCGGCGGAGCAGGCAGCCGGCGGCCGATCTCGGGTG
 
. : . : . : . : . : . :
JMFN034J02+ AGTCTGGTTCAGCGAGGTGCGCAGCGGCGAGTAAGTTTGGGAGAGGGAGTTAGGGA
JMFN046L13+ AGTCTGGTTCAGCGAGGTGCGCAGCGGCGAGTAAGTTTGG
JMSF045A20+ AGTCTGGTTCAGCGAGGTGCGCAGCGGCGAGTAAGTTTGGGAGAGGGAGTTAGGGACTTC
                      ____________________________________________________________
consensus AGTCTGGTTCAGCGAGGTGCGCAGCGGCGAGTAAGTTTGGGAGAGGGAGTTAGGGACTTC