Previous Contig 007644:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015C07Sequence121007644 (20)515007644 (20)pir|A26014|A260142e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFF016K08Sequence122007644 (20)
JMFF017I06Sequence472007644 (20)pir|A26014|A260141e-65histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI624007644 (20)pir|A26014|A260141e-68histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFF030E12Sequence470007644 (20)pir|A26014|A260141e-65histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI532007644 (20)pir|A26014|A260143e-67histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFF030K06Sequence471007644 (20)pir|A26014|A260141e-65histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI521007644 (20)pir|A26014|A260144e-67histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFF033E18Sequence540007644 (20)pir|A26014|A260142e-69histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFF037E16Sequence582007644 (20)pir|A26014|A260143e-69histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI528007644 (20)pir|A26014|A260141e-66histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFF043A23Sequence637007644 (20)pir|A26014|A260143e-69histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI589007644 (20)pir|A26014|A260143e-67histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFN006N13Sequence598007644 (20)pir|A26014|A260143e-69histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFN008I05Sequence600007644 (20)pir|A26014|A260143e-69histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFN034L07Sequence602007644 (20)pir|A26014|A260143e-69histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF045A16Sequence634007644 (20)pir|A26014|A260143e-69histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI594007644 (20)pir|A26014|A260143e-69histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF047A16Sequence235007644 (20)gb:ALFHISH3A_18189771e-31Alfalfa histone H3 (H3-1.1) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043A23- CCTTATGGCGGATCACCCTGG
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGG
 
. : . : . : . : . : . :
rJMFF043A23- AGAGTTTTTTTTTTTTTTTTCXXXXXXXXXXXXXXXXXXAAACAAGCAATAATTGCATTC
rJMFF017I06- AGCAATAATTGCATTC
JMFN034L07+ CAAGCAATAATTGCATTC
JMFN008I05+ AAACAAGCAATAATTGCATTC
JMFN006N13+ AAACAAGCAATAATTGCATTC
JMFF043A23+ AAACAAGCAATAATTGCATTC
                      ____________________________________________________________
consensus AGAGTTTTTTTTTTTTTTTTCNNNNNNNNNNNNNNNNNNAAACAAGCAATAATTGCATTC
 
. : . : . : . : . : . :
rJMFF043A23- CACTTAATTTCTTCCTGCTAGGATTACAATAATACTGCAAATGACTTGTTCCTAAGATTA
rJMFF017I06- CACTTAATTTCTTCCTGCTAGGATTACAATAATACTGCAAATGACTTGTTCCTAAGATTA
JMFN034L07+ CACTTAATTTCTTCCTGCTAGGATTACAATAATACTGCAAATGACTTGTTCCTAAGATTA
JMFN008I05+ CACTTAATTTCTTCCTGCTAGGATTACAATAATACTGCAAATGACTTGTTCCTAAGATTA
JMFN006N13+ CACTTAATTTCTTCCTGCTAGGATTACAATAATACTGCAAATGACTTGTTCCTAAGATTA
rJMFF037E16- CTTAATTTCTTCCTGCTAGGATTACAATAATACTGCNNATGACTTGTTCCTAAGATTA
rJMFF030E12- CTTAATTTCTTNCTGCTANGATTACAATAATACTGCNNATGANTTGTTCCTAAGATTA
rJMFF030K06- ACTTAATTTCTTNCTGCTANGATTACAATAATACTGCNNATGACTTGTTCCTAAGATTA
rJMFF015C07- TTTCTTCCTGCTAGGATTACAATANTACTGCAAATGACTTGTTCNTANNATTA
JMFF043A23+ CACTTAATTTCTTCCTGCTAGGATTACAATAATACTGCAAATGACTTGTTCCTAAGATTA
JMFF037E16+ CTGCTAGGATTACAATAATACTGCAAATGACTTGTTCCTAAGATTA
JMFF033E18+ ATTA
rJMSF045A16- ATTTCTTCCTGCTAGGATTACAATAATACTGCAAATGACTTGTTCCTAAGATTA
                      ____________________________________________________________
consensus CACTTAATTTCTTCCTGCTAGGATTACAATAATACTGCAAATGACTTGTTCCTAAGATTA
 
. : . : . : . : . : . :
rJMFF043A23- CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
rJMFF017I06- CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
JMFN034L07+ CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
JMFN008I05+ CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
JMFN006N13+ CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
rJMFF037E16- CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAANAGATTAAGCCCTCTCGC
rJMFF030E12- CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAANAGATTAAGCCCTCTCGC
rJMFF030K06- CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAANAGATTAAGCCCTCTCGC
rJMFF015C07- CAATAATACATAGTGCAAGCCAANAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
JMFF043A23+ CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
JMFF037E16+ CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
JMFF033E18+ CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
rJMSF045A16- CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
JMSF045A16+ ATTAAGCCCTCTCGC
                      ____________________________________________________________
consensus CAATAATACATAGTGCAAGCCAAAAAAGCACATTAATAAGAAGAGATTAAGCCCTCTCGC
 
. : . : . : . : . : . :
rJMFF043A23- CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
rJMFF017I06- CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMFN034L07+ CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMFN008I05+ CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMFN006N13+ CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
rJMFF037E16- CTCTGATTCTCCTANCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
rJMFF030E12- CTCTGATTCTCCTANCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
rJMFF030K06- CTCTGATTCTCCTANCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
rJMFF015C07- CTCTGATTCTCCTAACGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMFF043A23+ CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMFF037E16+ CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMFF033E18+ CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMFF017I06+ TCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMFF030K06+ CTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMFF030E12+ TCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
rJMSF045A16- CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
JMSF045A16+ CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
                      ____________________________________________________________
consensus CTCTGATTCTCCTAGCGAGCTGCATGTCTTTGGGCATAATGGTGACCCTCTTGGCGTGAA
 
. : . : . : . : . : . :
rJMFF043A23- TGGCGCAAAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
rJMFF017I06- TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
JMFN034L07+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
JMFN008I05+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
JMFN006N13+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
rJMFF037E16- TGGCGCANAGATTGGTATCTTCAAACAGTCCAACGAGGTANGCCTCGGCGGCCTCCTGCA
rJMFF030E12- TGGCGCANAGATTGGTATCTTCAAACAGTCCAACGAGGTANGCCTCGGCGGCCTCCTGCA
rJMFF030K06- TGGCGCANAGATTGGTATCTTCAAACAGTCCAACGAGGTANGCCTCGGCGGCCTCCTGCA
rJMFF015C07- TGGCGCANANATTGGTATCTTCNAACAGTCCAACGAGGTANGCCTCGGNGGCCTCCTGCA
JMFF043A23+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
JMFF037E16+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
JMFF033E18+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
JMFF017I06+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
JMFF030K06+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
JMFF030E12+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
rJMSF045A16- TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
JMSF045A16+ TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
                      ____________________________________________________________
consensus TGGCGCAGAGATTGGTATCTTCAAACAGTCCAACGAGGTAGGCCTCGGCGGCCTCCTGCA
 
. : . : . : . : . : . :
rJMFF043A23- ACGCGGAAACAGCACTGCTCTGGAAGCGAAAATCAGTCTTGAAGTCCTGAGCAATTTCCC
rJMFF017I06- ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTATTGAAGTCCTGAGCAATTTCCC
JMFN034L07+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
JMFN008I05+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
JMFN006N13+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
rJMFF037E16- ACGCGGAAACAGCACTGCTCTGGAANCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
rJMFF030E12- ACGCGGAAACAGCACTGCTCTGGAANCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
rJMFF030K06- ACGCGGAAACAGCACTGCTCTGGAANCGAAGATCANTCTTGAAGTCCTGAGCAATTTCCC
rJMFF015C07- ACGCGGAAACAGCACTGCTCTGGAAGCNAAGATCANTCTTGAAGTCCTGANCAATTTCCC
JMFF043A23+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
JMFF037E16+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
JMFF033E18+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
JMFF017I06+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTATTGAAGTCCTGAGCAATTTCCC
JMFF030K06+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
rJMSF047A16- CTTGAAGTCCTGAGCAATTTCCC
JMFF030E12+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
rJMSF045A16- ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
JMSF045A16+ ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
                      ____________________________________________________________
consensus ACGCGGAAACAGCACTGCTCTGGAAGCGAAGATCAGTCTTGAAGTCCTGAGCAATTTCCC
 
. : . : . : . : . : . :
rJMFF043A23- TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
rJMFF017I06- TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
JMFN034L07+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
JMFN008I05+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
JMFN006N13+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
rJMFF037E16- TCACCANCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCANTGCTCTTCTGGTACTTTC
rJMFF030E12- TCACCANCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
rJMFF030K06- TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
rJMFF015C07- TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCANTGCTCTTCTGGTACTTTC
JMFF043A23+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
JMFF037E16+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
JMFF033E18+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
JMFF017I06+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
JMFF030K06+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
rJMSF047A16- TCACCAGCCTCTGGAACGGCAGCTTTCNGATCAACAGCTCATTGCNCTTCTGGTACTTTC
JMFF030E12+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
rJMSF045A16- TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
JMSF045A16+ TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
                      ____________________________________________________________
consensus TCACCAGCCTCTGGAACGGCAGCTTTCGGATCAACAGCTCAGTGCTCTTCTGGTACTTTC
 
. : . : . : . : . : . :
rJMFF043A23- GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
rJMFF017I06- GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
JMFN034L07+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
JMFN008I05+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
JMFN006N13+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
rJMFF037E16- GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
rJMFF030E12- GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
rJMFF030K06- GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
rJMFF015C07- GGATCTCCCTCANNGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
JMFF043A23+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
JMFF037E16+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
JMFF033E18+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
JMFF017I06+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
JMFF030K06+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
rJMSF047A16- NNATCTCCCTCAGNGCAACNGTTNCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGN
JMFF030E12+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
rJMSF045A16- GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
JMSF045A16+ GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
                      ____________________________________________________________
consensus GGATCTCCCTCAGTGCAACAGTTCCAGGACGGAACCGGTGGGGCTTCTTCACACCACCGG
 
. : . : . : . : . : . :
rJMFF043A23- TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
rJMFF017I06- TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMFN034L07+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMFN008I05+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMFN006N13+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
rJMFF037E16- TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
rJMFF030E12- TCGCAGGGGNAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
rJMFF030K06- TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
rJMFF015C07- TCGCANGGGCAGATTTCCNAGNTGCCTTAGTTGCCAGNTGCTTCCGAGGANCCTTGCCTC
JMFF043A23+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMFF037E16+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMFF033E18+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMFF017I06+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMFF030K06+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
rJMSF047A16- TCGCAGGGGNAGATTTCCGAGCTGCCTTANTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMFF030E12+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMFF016K08+ C
JMFF015C07+ TC
rJMSF045A16- TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
JMSF045A16+ TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
                      ____________________________________________________________
consensus TCGCAGGGGCAGATTTCCGAGCTGCCTTAGTTGCCAGTTGCTTCCGAGGAGCCTTGCCTC
 
. : . : . : . : . : . :
rJMFF043A23- CGGTTGATTTCCGAGCGGTTTGCTTCGT
rJMFF017I06- CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMFN034L07+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMFN008I05+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMFN006N13+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
rJMFF037E16- CGGNTGATTTCCGAGCGGNTTGCTTCGTTCTCGCCATTTCGCCGACGGCT
rJMFF030E12- CGGNTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAG
rJMFF030K06- CGGNTGATTTCCGAGCGGGTTGCTTCGTTCTCGCCATTTCGC
rJMFF015C07- CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCNCCATTTC
JMFF043A23+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMFF037E16+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMFF033E18+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMFF017I06+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMFF030K06+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
rJMSF047A16- CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTC
JMFF030E12+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMFF016K08+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMFF015C07+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
rJMSF045A16- CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
JMSF045A16+ CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
                      ____________________________________________________________
consensus CGGTTGATTTCCGAGCGGTTTGCTTCGTTCTCGCCATTTCGCCGACGGCTAGGGCTTGTT
 
. : . : . : . : . : . :
rJMFF017I06- TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCTGAC
JMFN034L07+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGA
JMFN008I05+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGA
JMFN006N13+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGG
JMFF043A23+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCTGAC
JMFF037E16+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCT
JMFF033E18+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCT
JMFF017I06+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCTGAC
JMFF030K06+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCTGAC
JMFF030E12+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCTGAC
JMFF016K08+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCT
JMFF015C07+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCTGAC
rJMSF045A16- TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCTGAC
JMSF045A16+ TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCTGACC
                      ____________________________________________________________
consensus TGATTGCTTTTCAATTATCTCTCTGTAGCACAAGTGGAAATGGAGATAAATGATCTGACC