Previous Contig 007642:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031E05Sequence540007642 (5)gb:AP003199_18250238e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B104737009665 (4)gb:AC123513_11924101e-40Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN
JMFS111B08Sequence627007642 (5)gb:AP003199_18250239e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B104
JMSF013J05Sequence577007642 (5)gb:AP003199_18250233e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B104689009665 (4)gb:AC123513_11924109e-41Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN
JMSF045A11Sequence638007642 (5)gb:AP005723_18565717e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN587009665 (4)gb:AC123513_11924107e-41Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN
JMSF046K20Sequence736007642 (5)gb:AP003199_18250233e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B104647009665 (4)gb:AC009465_15367771e-05Arabidopsis thaliana chromosome 3 BAC T9J14 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046K20+ GAAGTGTAACCATTTG
                      ____________________________________________________________
consensus GAAGTGTAACCATTTG
 
. : . : . : . : . : . :
JMSF046K20+ TAAAAAAAGCTGGCCTTGCAGGGGGGTTGAACTGATAAGGTGGTGGTTTCATCGAAGTAC
JMFS111B08+ CATCGAAGTAC
JMSF045A11+ GGGGGTTGACCTGATGAGGTGGTGGTCTCATCGAAGTAC
                      ____________________________________________________________
consensus TAAAAAAAGCTGGCCTTGCAGGGGGGTTGACCTGATGAGGTGGTGGTTTCATCGAAGTAC
 
. : . : . : . : . : . :
JMSF046K20+ TTCTAATTGAAACTCTACATTTACTGTCATATATAGACCTTTTTGTTTGGTCTGAAAGCA
JMFS111B08+ TTCTAATTGAAACTCTACATTTACTGTCATATATAGACCTTTTTGTTTGGTCTGAAAGCA
JMSF045A11+ TTCTAATTGAAACTCTACATTTACTGTCATATATAGACCTTTTTGTTTGGTCTGAAAGCA
                      ____________________________________________________________
consensus TTCTAATTGAAACTCTACATTTACTGTCATATATAGACCTTTTTGTTTGGTCTGAAAGCA
 
. : . : . : . : . : . :
JMSF046K20+ CAACATTTGCCTCCCCAATAAGCTTAAAAGCAGCTTCTGCACCAGGGAACTTGTTCTTGT
JMFS111B08+ GAACATTTGCCTCCCCAATAAGCTTAAAAGCAGCTTCTGCACCAGGGAACTTGTTCTTGT
JMSF013J05+ CTTAAAAGCAGCTTCTGCACCAGGGAACTTGTTCTTGT
JMFF031E05+ GT
JMSF045A11+ GAACATTTGCCTCCCCAATAAGCTTAAAAGCAGCTTCTGCACCAGGGAACTTGTTCTTGT
                      ____________________________________________________________
consensus GAACATTTGCCTCCCCAATAAGCTTAAAAGCAGCTTCTGCACCAGGGAACTTGTTCTTGT
 
. : . : . : . : . : . :
JMSF046K20+ CGGGGTGAAGGACAAGTGCGAGTTTTCGGTACTGTTTCTTAATGGTTACTTCATCTGCTG
JMFS111B08+ CGGGGTGAAGGACAAGTGCGAGCTTCCGGTACTGTTTCTTAATGGTTACTTCATCTGCTG
JMSF013J05+ CGGGGTGAAGGACAAGTGCGAGCTTCCGGTACTGTTTCTTAATGGTTACTTCATCTGCTG
JMFF031E05+ CGGGGTGAAGGACAAGTGCGAGCTTCCGGTACTGTTTCTTAATGGTTACTTCATCTGCTG
JMSF045A11+ CGGGGTGAAGGACAAGTGCGAGCTTCCGGTACTGTTTCTTAATGGTTACTTCATCTGCTG
                      ____________________________________________________________
consensus CGGGGTGAAGGACAAGTGCGAGCTTCCGGTACTGTTTCTTAATGGTTACTTCATCTGCTG
 
. : . : . : . : . : . :
JMSF046K20+ ATCTATCAACTTGAAGGATTCCATACCAATCCTTGTCCAATCCCACCATGTTTTTAGCTG
JMFS111B08+ ATCTATCAACTTGAAGGATTCCATACCAATCCTTGTCCAATCCCAACATGTTTTTAGCTG
JMSF013J05+ ATCTATCAACTTGAAGGATTCCATACCAATCCTTGTCCAATCCCAACATGTTTTTAGCTG
JMFF031E05+ ATCTATCAACTTGAAGGATACCATACCAATCCTTGTCCAATCCCAACATGTTTTTAGCTG
JMSF045A11+ ATCTATCAACTTGAAGGATTCCATACCAATCCTTGTCCAATCCCAACATGTTTTTAGCTG
                      ____________________________________________________________
consensus ATCTATCAACTTGAAGGATTCCATACCAATCCTTGTCCAATCCCAACATGTTTTTAGCTG
 
. : . : . : . : . : . :
JMSF046K20+ AACAATGAACATTGCAGACAGCTAGCAACTGATTAATGTTCTCTAGATCAGGGTAAAGTC
JMFS111B08+ AACAATGAACATTGCAGACAGCTAGCAACTGATTAATGTTCTCTAGATCAGGGTAAAGTC
JMSF013J05+ AACAATGAACATTGCAGACAGCTAGCAACTGATTAATGTTCTCTAGATCAGGGTAAAGTC
JMFF031E05+ AACAATGAACATTGCAGACAGCTAGCAACTGATTAATGTTCTCTAGATCAGGGTAAAGTC
JMSF045A11+ AACAATGAACATTGCAGACAGCTAGCAACTGATTAATGTTCTCTAGATCAGGGTAAAGTC
                      ____________________________________________________________
consensus AACAATGAACATTGCAGACAGCTAGCAACTGATTAATGTTCTCTAGATCAGGGTAAAGTC
 
. : . : . : . : . : . :
JMSF046K20+ GTTGAGCTTTAGCTGCAATCTTCTGGGCCACTTCAAAATCATTATTTTGCATTTTCTTCT
JMFS111B08+ GTTGAGCTTTAGCTGCAACCTTCTGGGCCCCTTCAAAATCATTATTTTGCATTTTCTTCT
JMSF013J05+ GTTGAGCTTTAGCTGCAACCTTCTGGGCCCCTTCAAAATCATTATTTTGCATTTTCTTCT
JMFF031E05+ GTTGAGCTTTAGCTGCAACCTTCTGGGCCCCTTCAAAATCATTATTTTGCATTTTCTTCT
JMSF045A11+ GTTGAGCTTTAGCTGCAACCTTCTGGGCCCCTTCAAAATCATTATTTTGCATTTTCTTCT
                      ____________________________________________________________
consensus GTTGAGCTTTAGCTGCAACCTTCTGGGCCCCTTCAAAATCATTATTTTGCATTTTCTTCT
 
. : . : . : . : . : . :
JMSF046K20+ CTGCAAGCTCCTTAGCCTTGAGGGCTTCATCTTTATTGCACTCCATCAATAGTACCAAAA
JMFS111B08+ CTGCAAGCTCCTTAGCCTTGAGGGCTTCATCTTTGTTGCACTCCATCAAAAGTACCAAAA
JMSF013J05+ CTGCAAGCTCCTTAGCCTTGAGGGCTTCATCTTTGTTGCACTCCATCAAAAGTACCAAAA
JMFF031E05+ CTGCAAGCTCCTTAGCCTTGAGGGCTTCATCTTTGTTGCACTCCATCAAAAGTACCAAAA
JMSF045A11+ CTGCAAGCTCCTTAGCCTTGAGGGCTTCATCTTTGTTGCACTCCATCAAAAGTACCAAAA
                      ____________________________________________________________
consensus CTGCAAGCTCCTTAGCCTTGAGGGCTTCATCTTTGTTGCACTCCATCAAAAGTACCAAAA
 
. : . : . : . : . : . :
JMSF046K20+ TATACATCAACCATTCAAATCACCAATGTGCAGCACATAAAATGAATCTGCAACCAGTCC
JMFS111B08+ AATACGTCAACCATTCAAATCACCAATGTGCAGTACAT-AAATGAACCTGCAACCAGTCC
JMSF013J05+ AATACGTCAACCATTCAAATCACCAATGTGCAGTACAT-AAATGAACCTGCAACCAGTCC
JMFF031E05+ AATACGTCAACCATTCAAATCACCAATGTGCAGTACAT-AAATGAACCTGCAACCAGTCC
JMSF045A11+ AATACGTCAACCATTCAAATCACCAATGTGCAGTACAT-AAATGAACCTGCAACCAGTCC
                      ____________________________________________________________
consensus AATACGTCAACCATTCAAATCACCAATGTGCAGTACAT-AAATGAACCTGCAACCAGTCC
 
. : . : . : . : . : . :
JMSF046K20+ TTTTCATGCCCAACA
JMFS111B08+ TTTTCATGCCCAACA
JMSF013J05+ TTTTCATGCCCAACA
JMFF031E05+ TTTTCATGCCCAACA
JMSF045A11+ TTTTCATGCCCAACAAGGAGTCAAGGAGTTGCCCTCTGCTCAGCCGTCCAGTCCACCGCC
                      ____________________________________________________________
consensus TTTTCATGCCCAACAAGGAGTCAAGGAGTTGCCCTCTGCTCAGCCGTCCAGTCCACCGCC
 
. : . : . : . : . : . :
JMSF045A11+ GGTCTGGTTCACGTCGTCACTCCACCGCTCCACCGCTGTCAGTTCCGCACGATGTCCCAC
                      ____________________________________________________________
consensus GGTCTGGTTCACGTCGTCACTCCACCGCTCCACCGCTGTCAGTTCCGCACGATGTCCCAC