Previous Contig 007632:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044M15Sequence734007632 (2)pir|H96573|H965731e-45protein F12M16.29 [imported] - Arabidopsis thaliana>gb:AE005173_893242 Arabidops721009121 (6)gb:BT020391_16427867e-64Arabidopsis thaliana At4g00840 mRNA, complete cds.>gb:BT020511_1642905 Arabidops
JMSF051E04Sequence666007632 (2)pir|H96573|H965732e-32protein F12M16.29 [imported] - Arabidopsis thaliana>gb:AE005173_893242 Arabidops689002525 (15)pir|S46306|S463062e-60cytochrome b5 - common tobacco>gb:NTCYTB5_1691534 N.tabacum mRNA for cytochrome

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044M15+ CTCGCGCATCAAAT
                      ____________________________________________________________
consensus CTCGCGCATCAAAT
 
. : . : . : . : . : . :
JMSF051E04+ TAGC
JMSF044M15+ TTGTCGGTTCACTCANAACGTACTTTGGTAACTCATACTTTGCACCTCTTTCGTCATAGC
                      ____________________________________________________________
consensus TTGTCGGTTCACTCANAACGTACTTTGGTAACTCATACTTTGCACCTCTTTCGTCATAGC
 
. : . : . : . : . : . :
JMSF051E04+ AGATTGTCAGATCAGAGGCTTGAACANTAATACCAGCACTGTCCACAATAGCCTGGGCAA
JMSF044M15+ AGATTGTCAGATCAGAGGCTTGAACAATAATACCAGCACTGTCCACAATAGCCTGGGCAA
                      ____________________________________________________________
consensus AGATTGTCAGATCAGAGGCTTGAACAATAATACCAGCACTGTCCACAATAGCCTGGGCAA
 
. : . : . : . : . : . :
JMSF051E04+ GGGATATGTCAGCCTCAGCAGCAGCCCTAAGTGCATCCCAGATCTCTTTCCGACCACCAT
JMSF044M15+ GGGATATGTCAGCCTCAGCAGCAGCCCTAAGTGCATCCCAGATCTCTTTCCGACCACCAT
                      ____________________________________________________________
consensus GGGATATGTCAGCCTCAGCAGCAGCCCTAAGTGCATCCCAGATCTCTTTCCGACCACCAT
 
. : . : . : . : . : . :
JMSF051E04+ AGTGTGGTGCCGTGTCCCAAAATTCATCACGCATCTGTACAAGTTGAGCCCTCGTTATTG
JMSF044M15+ AGTGTGGTGCCGTGTCCCAAAATTCATCACGCATCTGTACAAGTTGAGCCCTCGTTATTG
                      ____________________________________________________________
consensus AGTGTGGTGCCGTGTCCCAAAATTCATCACGCATCTGTACAAGTTGAGCCCTCGTTATTG
 
. : . : . : . : . : . :
JMSF051E04+ CTTCTGAATGTTTCCANGGTTTTGGCTTCCGTATCTTCTTAACAGTCTCATCTCCNTTCG
JMSF044M15+ CTTCTGAATGTTTCCAAGGTTTTGGCTTCCGTATCTTCTTAACAGTCTCATCTCCTTTCG
                      ____________________________________________________________
consensus CTTCTGAATGTTTCCAAGGTTTTGGCTTCCGTATCTTCTTAACAGTCTCATCTCCTTTCG
 
. : . : . : . : . : . :
JMSF051E04+ AACGCGAAGATCCCGAGCAGCCCANGCTACACAGCCACTGGGAATCTTGGGTAGCTAGCT
JMSF044M15+ AACGCGAAGATCCCGAGCAGCCCANGCTACACANCCACTGGGAATCTTGGGTAGCTAGCT
                      ____________________________________________________________
consensus AACGCGAAGATCCCGAGCAGCCCANGCTACACAGCCACTGGGAATCTTGGGTAGCTAGCT
 
. : . : . : . : . : . :
JMSF051E04+ AATTCAGGAATCTATATATATAAATATATCCACGGCAGATATATATATATACACACACAG
JMSF044M15+ AATTCAGGAATCTATATATATAAATATATCCACGGCAGATATATATATATACACACACAG
                      ____________________________________________________________
consensus AATTCAGGAATCTATATATATAAATATATCCACGGCAGATATATATATATACACACACAG
 
. : . : . : . : . : . :
JMSF051E04+ AGTAGAGAGAAAGAGATTACAGGAAATGAATTTATCGGTACTTGTTTTGAGAGCTTTTGC
JMSF044M15+ AGTAGAGAGAAAGAGATTACAGGAAATGAATTTATCGGTACTTGTTTTGAGAGCTTTTGC
                      ____________________________________________________________
consensus AGTAGAGAGAAAGAGATTACAGGAAATGAATTTATCGGTACTTGTTTTGAGAGCTTTTGC
 
. : . : . : . : . : . :
JMSF051E04+ GTGCTCGCGACTCTATCTCATTCCCAGCTATACACATACACACACACATATATGTATATA
JMSF044M15+ GTGCTCGCGACTCTATCTCATTCCCAGCTATACACATACACACACACATATATGTATATA
                      ____________________________________________________________
consensus GTGCTCGCGACTCTATCTCATTCCCAGCTATACACATACACACACACATATATGTATATA
 
. : . : . : . : . : . :
JMSF051E04+ TATAACCTGTACTCTCTCCTCTTCTCTCTCTCTCTACATATACATATATGTGGTGTATGT
JMSF044M15+ TATAACCTGTACTCTCTCCTCTTCTCTCTCTCTCTACATATACATATATGTGGTGTATGT
                      ____________________________________________________________
consensus TATAACCTGTACTCTCTCCTCTTCTCTCTCTCTCTACATATACATATATGTGGTGTATGT
 
. : . : . : . : . : . :
JMSF051E04+ ATCCGTCAGTTTTGGGTATTTACCATGGACGCGCGGTGAAACAGAGTGTCCGTTTGTAGA
JMSF044M15+ ATCCGTCAGTTTTGGGTATTTACCATGGACGCGCGGTGAAACAGAGTGTCCGTTTGTAGA
                      ____________________________________________________________
consensus ATCCGTCAGTTTTGGGTATTTACCATGGACGCGCGGTGAAACAGAGTGTCCGTTTGTAGA
 
. : . : . : . : . : . :
JMSF051E04+ GAGAGAGAGAGAGAGAGATGAAGAGGTGGAGAAGATGAAGGAGACTAGGAGAGTCCAC
JMSF044M15+ GAGAGAGAGAGAGAGAGATGAAGAGGTGGAGAAGATGAAGGAGACTAGGAGAGTCCACTC
                      ____________________________________________________________
consensus GAGAGAGAGAGAGAGAGATGAAGAGGTGGAGAAGATGAAGGAGACTAGGAGAGTCCACTC