Previous Contig 007625:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044L15Sequence737007625 (2)gb:PSA316577_17019730.026Pisum sativum chloroplast mRNA for putative cloroplast thioredoxin m2 (trxm2 gen680007625 (2)gb:PSA316577_17019730.022Pisum sativum chloroplast mRNA for putative cloroplast thioredoxin m2 (trxm2 gen

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044L15+ GGGAGTGTGGCAGCCAT
JMSF044L15- GGGAGTGTGGCAGCCAT
                      ____________________________________________________________
consensus GGGAGTGTGGCAGCCAT
 
. : . : . : . : . : . :
rJMSF044L15+ TCATTCGTCACCTAATCCGAATGATCCGTACGCCCAACTACCCAACAAATTCTACTACTC
JMSF044L15- TCATTCGTCACCTAATCCGAATGATCCGTACGCCCAACTACCCAACAAATTCTACTACTC
                      ____________________________________________________________
consensus TCATTCGTCACCTAATCCGAATGATCCGTACGCCCAACTACCCAACAAATTCTACTACTC
 
. : . : . : . : . : . :
rJMSF044L15+ GCCCCGTCGCCCGCTACTCTCTTTCACTCACTCTCTTTCCATTTCCCTGTAAATATCACA
JMSF044L15- GCCCCGTCGCCCGCTACTCTCTTTCACTCACTCTCTTTCCATTTCCCTGTAAATATCACA
                      ____________________________________________________________
consensus GCCCCGTCGCCCGCTACTCTCTTTCACTCACTCTCTTTCCATTTCCCTGTAAATATCACA
 
. : . : . : . : . : . :
rJMSF044L15+ CCCTTCAATTCTGCCATGGCAGTTGTACTGGAAGCTCTCACTACAGTTCCTCGCTCCTTC
JMSF044L15- CCCTTCAATTCTGCCATGGCAGTTGTACTGGAAGCTCTCACTACAGTTCCTCGCTCCTTC
                      ____________________________________________________________
consensus CCCTTCAATTCTGCCATGGCAGTTGTACTGGAAGCTCTCACTACAGTTCCTCGCTCCTTC
 
. : . : . : . : . : . :
rJMSF044L15+ CCTCTCACGTCGGTCTCATCCTCATTGGCTCCCGTCGCCGCCTCTTCCATCTCCTGTAGG
JMSF044L15- CCTCTCACGTCGGTCTCATCCTCATTGGCTCCCGTCGCCGCCTCTTCCATCTCCTGTAGG
                      ____________________________________________________________
consensus CCTCTCACGTCGGTCTCATCCTCATTGGCTCCCGTCGCCGCCTCTTCCATCTCCTGTAGG
 
. : . : . : . : . : . :
rJMSF044L15+ TTAAACTCCGTTCGGTTCTCCCACTTCCGCGGTCTTAAGATCCAACCGCCTCGCTCAATC
JMSF044L15- TTAAACTCCGTTCGGTTCTCCCACTTCCGCGGTCTTAAGATCCAACCGCCTCGCTCAATC
                      ____________________________________________________________
consensus TTAAACTCCGTTCGGTTCTCCCACTTCCGCGGTCTTAAGATCCAACCGCCTCGCTCAATC
 
. : . : . : . : . : . :
rJMSF044L15+ GTTTCCACCTCTAAATTACCTCCACGCGGAAGCCCCATCGTCTGCGAGGCTCAGAATACC
JMSF044L15- GTTTCCACCTCTAAATTACCTCCACGCGGAAGCCCCATCGTCTGCGAGGCTCAGAATACC
                      ____________________________________________________________
consensus GTTTCCACCTCTAAATTACCTCCACGCGGAAGCCCCATCGTCTGCGAGGCTCAGAATACC
 
. : . : . : . : . : . :
rJMSF044L15+ GCAGTTGAAGGATAATAAGGCTAGCACCCGACCCGGATCATAAGTGTGCATCTGACCCGG
JMSF044L15- GCAGTTGAAGGATAATAAGGCTAGCACCCGACCCGGATCATAAGTGTGCATCTGACCCGG
                      ____________________________________________________________
consensus GCAGTTGAAGGATAATAAGGCTAGCACCCGACCCGGATCATAAGTGTGCATCTGACCCGG
 
. : . : . : . : . : . :
rJMSF044L15+ CACCATAGTTGACCCGACACCGCATGGATGCTCCAACGGTTAGAATTCCAACAGGTGTCA
JMSF044L15- CACCATAGTTGACCCGACACCGCATGGATGCTCCAACGGTTAGAATTCCAACAGGTGTCA
                      ____________________________________________________________
consensus CACCATAGTTGACCCGACACCGCATGGATGCTCCAACGGTTAGAATTCCAACAGGTGTCA
 
. : . : . : . : . : . :
rJMSF044L15+ CATCTAATGTCATTGAAGCCACCATTGATGCCACCATTGATGAGAGAGAGTTAAAGCCTC
JMSF044L15- CATCTAATGTCATTGAAGCCACCATTGATGCCACCATTGATGAGAGAGAGTTAAAGCCTC
                      ____________________________________________________________
consensus CATCTAATGTCATTGAAGCCACCATTGATGCCACCATTGATGAGAGAGAGTTAAAGCCTC
 
. : . : . : . : . : . :
rJMSF044L15+ AACGCCTCATTCATGACTCTTCATATTCCTGTCGTTAGCTCAGCTCCCCAAGGATGTCTC
JMSF044L15- AACGCCTCATTCATGACTCTTCATATTCCTGTCGTTAGCTCAGCTCCCCAAGGATGTCTC
                      ____________________________________________________________
consensus AACGCCTCATTCATGACTCTTCATATTCCTGTCGTTAGCTCAGCTCCCCAAGGATGTCTC
 
. : . : . : . : . : . :
rJMSF044L15+ TTCATGTTGTTACCGTTAGGACCTAGCATAAATAGAACTTCCCTCAGCTGAGCAGG
JMSF044L15- TTCATGTTGTTACCGTTAGGACCTAGCATAAATAGAACTTCCCTCAGCTGAGCAGGACAC
                      ____________________________________________________________
consensus TTCATGTTGTTACCGTTAGGACCTAGCATAAATAGAACTTCCCTCAGCTGAGCAGGACAC
 
. : . : . : . : . : . :
JMSF044L15- ACTGTACTTTCTATACTGAGACAAAGGCAATACAACTATTGTTACTCTCTAAAAAAAAAA
                      ____________________________________________________________
consensus ACTGTACTTTCTATACTGAGACAAAGGCAATACAACTATTGTTACTCTCTAAAAAAAAAA