Previous Contig 007612:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044I19Sequence702007612 (2)pir|T12583|T125839e-42oleoyl-[acyl-carrier-protein] hydrolase (EC 3.1.2.14) - common sunflower>gb:AF03766013887 (2)gb:GMU92878_16807574e-63Garcinia mangostana acyl-ACP thioesterase (FatB1) mRNA, nuclear gene encoding ch
JMSF050H14Sequence663007612 (2)pir|T12583|T125832e-35oleoyl-[acyl-carrier-protein] hydrolase (EC 3.1.2.14) - common sunflower>gb:AF03771013887 (2)gb:GMU92878_16807575e-66Garcinia mangostana acyl-ACP thioesterase (FatB1) mRNA, nuclear gene encoding ch

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044I19+ TTCTGACGAAAAATTAATCCCTCTTGCATAATTCTTCCCAAA
                      ____________________________________________________________
consensus TTCTGACGAAAAATTAATCCCTCTTGCATAATTCTTCCCAAA
 
. : . : . : . : . : . :
JMSF050H14+ TTTGTCTTCCAATCAAGCATCATCCATTGC
JMSF044I19+ CCAAAAGGATCAATGAGTTCATCTGAGCGTTTTGTCTTCCAATCAAGCATCATCCATTGC
                      ____________________________________________________________
consensus CCAAAAGGATCAATGAGTTCATCTGAGCGTTTTGTCTTCCAATCAAGCATCATCCATTGC
 
. : . : . : . : . : . :
JMSF050H14+ TTCTCAGCAGCCAAGAAAACTGTTGTAATGGCAGCAAGGAGCATGCTCCAGTCAGGCAAC
JMSF044I19+ TTCTCAGCAGCCAAGAAAACTGTTGTAATGGCAGCAAGGAGCATGCTCCAGTCAGGCAAC
                      ____________________________________________________________
consensus TTCTCAGCAGCCAAGAAAACTGTTGTAATGGCAGCAAGGAGCATGCTCCAGTCAGGCAAC
 
. : . : . : . : . : . :
JMSF050H14+ TGATTGATAAAGGTCCTTGGGTGAGAAGATGAGGTCACCTCATCGTCAGTTTTGTGGCCT
JMSF044I19+ TGATTGATAAAGGTCCTTGGGTGAGAAGATGAGGTCACCTCATCGTCAGTTTTGTGGCCT
                      ____________________________________________________________
consensus TGATTGATAAAGGTCCTTGGGTGAGAAGATGAGGTCACCTCATCGTCAGTTTTGTGGCCT
 
. : . : . : . : . : . :
JMSF050H14+ TCCATAACACCTATCTTGGTTCCATTAACCTTGGGAGGTGCTTGTGCACTGGCTTTCACT
JMSF044I19+ TCCATAACACCTATCTTGGTTCCATTAACCTTGGGAGGTGCTTGTGCACTGGCTTTCACT
                      ____________________________________________________________
consensus TCCATAACACCTATCTTGGTTCCATTAACCTTGGGAGGTGCTTGTGCACTGGCTTTCACT
 
. : . : . : . : . : . :
JMSF050H14+ TGTAAGTTTCGAGAGGTAGAAGATTTTGGCTTAATGCCCCGTGCATTGAGGCTTACAGGT
JMSF044I19+ TGTAAGTTTCGAGAGGTAGAAGATTTTGGCTTAATGCCCCGTGCATTGAGGCTTACAGGT
                      ____________________________________________________________
consensus TGTAAGTTTCGAGAGGTAGAAGATTTTGGCTTAATGCCCCGTGCATTGAGGCTTACAGGT
 
. : . : . : . : . : . :
JMSF050H14+ GCAGTTCCTCCCAACTTTCCAGATGTTTGGGCACCAGACTCCGGAGTCAGATTGCCAACA
JMSF044I19+ GCAGTTCCTCCCAACTTTCCAGATGTTTGGGCACCAGACTCCGGAGTCAGATTGCCAACA
                      ____________________________________________________________
consensus GCAGTTCCTCCCAACTTTCCAGATGTTTGGGCACCAGACTCCGGAGTCAGATTGCCAACA
 
. : . : . : . : . : . :
JMSF050H14+ GGAAAAAATGCAGCAGTAGCAGCAGTGGCAACCATGATGGAATTACTATAGCTAAGTAGT
JMSF044I19+ GGAAAAAATGCAGCAGTAGCAGCAGTGGCAACCATGATGGAATTACTATAGCTAAGTAGT
                      ____________________________________________________________
consensus GGAAAAAATGCAGCAGTAGCAGCAGTGGCAACCATGATGGAATTACTATAGCTAAGTAGT
 
. : . : . : . : . : . :
JMSF050H14+ TGGTGTAATATCAACAAATTCACAAGACAATCAACAGATGAATCCTTAAAAGATCACCAA
JMSF044I19+ TGGTGTAATATCAACAAATTCACAAGACAATCAACAGATGAATCCTTAAAAGATCACCAA
                      ____________________________________________________________
consensus TGGTGTAATATCAACAAATTCACAAGACAATCAACAGATGAATCCTTAAAAGATCACCAA
 
. : . : . : . : . : . :
JMSF050H14+ TATCCATCAAACAGTGACTTTTTCTCCCTTTTCCGGCACAGAATCTTCACCTTTTCCGGC
JMSF044I19+ TATCCATCAAACAGTGACTTTTTCTCCCTTTTCCGGCACAGAATCTTCACCTTTTCCGGC
                      ____________________________________________________________
consensus TATCCATCAAACAGTGACTTTTTCTCCCTTTTCCGGCACAGAATCTTCACCTTTTCCGGC
 
. : . : . : . : . : . :
JMSF050H14+ ACAGAATCTTCTAGTAACTGAACATCGAATGCATGCATATGAGTTACAGAAGCTTCGTTT
JMSF044I19+ ACAGAATCTTCTAGTAACTGAACATCGAATGCATGCATATGAGTTACAGAAGCTTCGTTT
                      ____________________________________________________________
consensus ACAGAATCTTCTAGTAACTGAACATCGAATGCATGCATATGAGTTACAGAAGCTTCGTTT
 
. : . : . : . : . : . :
JMSF050H14+ CTCTTTCCAGTTTCCAGCAAAAACCCGTATTGCGTGCCTTCTAGGGCTTGTTTGCTATCC
JMSF044I19+ CTCTTTCCAGTTTCCAGCAAAAACCCGTATTGCGTGCCTTCTAGGGCTTGTTTGCTATCC
                      ____________________________________________________________
consensus CTCTTTCCAGTTTCCAGCAAAAACCCGTATTGCGTGCCTTCTAGGGCTTGTTTGCTATCC