Previous Contig 007606:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001F04Sequence353007606 (3)gb:AP003749_18328405e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11731011143 (2)gb:AP003749_18328404e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMSF044G12Sequence697007606 (3)gb:AP003749_18328407e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMSF049L07Sequence687007606 (3)gb:AP003749_18328404e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001F04+ TTTTTGTGGAGTTGG
                      ____________________________________________________________
consensus TTTTTGTGGAGTTGG
 
. : . : . : . : . : . :
JMSF001F04+ GTGGGGCTTACCTGTAATATAGGAAGTGATGCATTGGTTCGTTTAGCCTGGGCATTCTTC
                      ____________________________________________________________
consensus GTGGGGCTTACCTGTAATATAGGAAGTGATGCATTGGTTCGTTTAGCCTGGGCATTCTTC
 
. : . : . : . : . : . :
JMSF001F04+ AAAAAGTGTGATTCATCGGCAATAACAACCTTGAACTCTGATGCCATTAAGGTATCCTGT
                      ____________________________________________________________
consensus AAAAAGTGTGATTCATCGGCAATAACAACCTTGAACTCTGATGCCATTAAGGTATCCTGT
 
. : . : . : . : . : . :
JMSF001F04+ AACTTAGGAACAGTGTCATAGGATATTATATTAAAGATGCCATCAAGTTGGATAGATCTC
                      ____________________________________________________________
consensus AACTTAGGAACAGTGTCATAGGATATTATATTAAAGATGCCATCAAGTTGGATAGATCTC
 
. : . : . : . : . : . :
JMSF001F04+ TTAGCATTTGAAGGCACAATTTTGAATCCTGCCCTATTTGAACCACTCAATTGAGATAAA
JMSF049L07+ AAGGCACAATTTTGAATCCTGCCCTATTTGAACCACTCAATTGAGATAAA
                      ____________________________________________________________
consensus TTAGCATTTGAAGGCACAATTTTGAATCCTGCCCTATTTGAACCACTCAATTGAGATAAA
 
. : . : . : . : . : . :
JMSF001F04+ ACCAC
JMSF049L07+ ACCACAAGGATATCTGAAGGTGAAATATCCAACCACTGTTGAATCATAGAAGCCCAATGA
                      ____________________________________________________________
consensus ACCACAAGGATATCTGAAGGTGAAATATCCAACCACTGTTGAATCATAGAAGCCCAATGA
 
. : . : . : . : . : . :
JMSF049L07+ AGACGCAACGAAGATGGAGTAAGAACAAGAACGGGCCATGATTCACGGACGCAAGAACTT
                      ____________________________________________________________
consensus AGACGCAACGAAGATGGAGTAAGAACAAGAACGGGCCATGATTCACGGACGCAAGAACTT
 
. : . : . : . : . : . :
JMSF049L07+ ACAGCAATGGCCTGAATTGTCTTTCCAAGTCCCATCTCGTCAGCTAAAAGAATCCGTGCA
                      ____________________________________________________________
consensus ACAGCAATGGCCTGAATTGTCTTTCCAAGTCCCATCTCGTCAGCTAAAAGAATCCGTGCA
 
. : . : . : . : . : . :
JMSF049L07+ CCATGTTGCAAGGCGAATCTTACTCCATCACACTGAAAAGGCATTAGCTTCGTTTTAATG
JMSF044G12+ TCCATCACACTGAAAAGGCATTAGCTTCGTTTTAATG
                      ____________________________________________________________
consensus CCATGTTGCAAGGCGAATCTTACTCCATCACACTGAAAAGGCATTAGCTTCGTTTTAATG
 
. : . : . : . : . : . :
JMSF049L07+ CTGTCAGGAATGGATTCATAGCGATCTTGAATATCACAAACTTCATTGGCAGCCACAATA
JMSF044G12+ CTGTCAGGAATGGATTCATAGCGATCTTGAATATCACAAACTTCATTGGCAGCCACAATA
                      ____________________________________________________________
consensus CTGTCAGGAATGGATTCATAGCGATCTTGAATATCACAAACTTCATTGGCAGCCACAATA
 
. : . : . : . : . : . :
JMSF049L07+ GCACGTTGCACCAACGGATCTAAGTTCTGAACCTCCACATTTGAGCTAGAAATTCCATTT
JMSF044G12+ GCACGTTGCACCAACGGATCTAAGTTCTGAACCTCCACATTTGAGCTAGAAATTCCATTT
                      ____________________________________________________________
consensus GCACGTTGCACCAACGGATCTAAGTTCTGAACCTCCACATTTGAGCTAGAAATTCCATTT
 
. : . : . : . : . : . :
JMSF049L07+ AGAA-TTTTTTCTGCTGATGACAATGATGACAGAGGAAACATCCACAATCTTTCTTTTGC
JMSF044G12+ AGAATTTTTTTCTGCTGATGACAATGATGACAGAGGAAACATCCACAATCTTTCTTTTGC
                      ____________________________________________________________
consensus AGAATTTTTTTCTGCTGATGACAATGATGACAGAGGAAACATCCACAATCTTTCTTTTGC
 
. : . : . : . : . : . :
JMSF049L07+ ATTCCAAAACGCTTTAGGTACTTTTCGCAGTGCATCTATAAGTAGCTGGTCATACAAAAA
JMSF044G12+ ATTCCAAAACGCTTTAGGTACTTTTCGCAGTGCATCTATAAGTAGCTGGTCATACAAAAA
                      ____________________________________________________________
consensus ATTCCAAAACGCTTTAGGTACTTTTCGCAGTGCATCTATAAGTAGCTGGTCATACAAAAA
 
. : . : . : . : . : . :
JMSF049L07+ CTTTGCAGCTATATCACCACTTGCATGGAGGAAAAGTTTAACAGAGCGTTTCTGTTGTTT
JMSF044G12+ CTTTGCAGCTATATCACCACTTGCATGGAGGAAAAGTTTAACAGAGCGTTTCTGTTGTTT
                      ____________________________________________________________
consensus CTTTGCAGCTATATCACCACTTGCATGGAGGAAAAGTTTAACAGAGCGTTTCTGTTGTTT
 
. : . : . : . : . : . :
JMSF049L07+ TTGTTGTGGTTGTTGTTGTCTTGACAAATTCT
JMSF044G12+ TTGTTGTGGTTGTTGTTGTCTTGACAAATTCTCAGTTGCCTTATTTGCTCCAAATGAAGG
                      ____________________________________________________________
consensus TTGTTGTGGTTGTTGTTGTCTTGACAAATTCTCAGTTGCCTTATTTGCTCCAAATGAAGG
 
. : . : . : . : . : . :
JMSF044G12+ CAGTATTCTCCGAGGAGGCGACTGAGCATTTTTCACAGAAGCAGAAGAGAGCTCCGGCCG
                      ____________________________________________________________
consensus CAGTATTCTCCGAGGAGGCGACTGAGCATTTTTCACAGAAGCAGAAGAGAGCTCCGGCCG
 
. : . : . : . : . : . :
JMSF044G12+ GTGGGGAGAGACCGGAGTATGGTGCACAGAGGTGGTGGCAGCATAAGACGAGGAATTGCG
                      ____________________________________________________________
consensus GTGGGGAGAGACCGGAGTATGGTGCACAGAGGTGGTGGCAGCATAAGACGAGGAATTGCG
 
. : . : . : . : . : . :
JMSF044G12+ CTCAGCGATTTGCCTCATTGCATCTCGCTCCAGAGAATCCAGCTCTTCCGCACTCGGTTC
                      ____________________________________________________________
consensus CTCAGCGATTTGCCTCATTGCATCTCGCTCCAGAGAATCCAGCTCTTCCGCACTCGGTTC
 
. : . : . : . : . : . :
JMSF044G12+ CCAGTCATCCAACTCCATTGAAGTCCAATCAGAGAATTGAAAAGGAAACTTTCAAAATTT
                      ____________________________________________________________
consensus CCAGTCATCCAACTCCATTGAAGTCCAATCAGAGAATTGAAAAGGAAACTTTCAAAATTT
 
. : . : . : . : . : . :
JMSF044G12+ TGGGGTGATTCAATATCATACAAGCAATTCAGCAAGGAAGGAAACTGAAGCTCCTGCACC
                      ____________________________________________________________
consensus TGGGGTGATTCAATATCATACAAGCAATTCAGCAAGGAAGGAAACTGAAGCTCCTGCACC