Previous Contig 007605:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027M22Sequence525007605 (7)gb:AF031244_17625365e-42Arabidopsis thaliana nodulin-like protein mRNA, partial cds.578009519 (7)gb:AB023037_15153776e-08Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFB16.>gb:AB025619_1516
JMFF031C23Sequence591007605 (7)gb:AF031244_17625367e-54Arabidopsis thaliana nodulin-like protein mRNA, partial cds.573009519 (7)gb:AB023037_15153771e-06Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFB16.>gb:AB025619_1516
JMSF012E19Sequence234007605 (7)756009519 (7)gb:ATAC010797_15431683e-40Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequenc
JMSF025A11Sequence650007605 (7)gb:AF031244_17625362e-59Arabidopsis thaliana nodulin-like protein mRNA, partial cds.758009519 (7)gb:ATAC010797_15431683e-40Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequenc
JMSF039I04Sequence727007605 (7)gb:AP005529_18535615e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070871009519 (7)gb:ATAC010797_15431686e-55Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequenc
JMSF040D14Sequence671007605 (7)gb:AP005529_18535614e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070867009519 (7)gb:ATAC010797_15431688e-49Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequenc
JMSF044G11Sequence811007605 (7)gb:AP005529_18535619e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070843009519 (7)gb:ATAC010797_15431687e-50Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040D14+ CCACAGGTCTCACTAAGAACATCACAGCAGTGATCACAATCGATGGCCCA
JMSF039I04+ CCCA
JMSF044G11+ CATCACAGCAGTGATCACAATCGATGGCCCA
                      ____________________________________________________________
consensus CCACAGGTCTCACTAAGAACATCACAGCAGTGATCACAATCGATGGCCCA
 
. : . : . : . : . : . :
JMSF040D14+ ACAGCAACCATGAAGACCAGTGATGATTGATCAGGGAAGTTGATCATGGTATAAAGTTGT
JMSF039I04+ NCAGCAACCATGAAGACCAGTGATGATTGATCAGGGAAGTTGATCATGGTATAAAGTTGT
JMSF044G11+ ACAGCAACCATGAAGACCAGTGATGATTGATCAGGGAAGTTGATCATGGTATAAAGTTGT
                      ____________________________________________________________
consensus ACAGCAACCATGAAGACCAGTGATGATTGATCAGGGAAGTTGATCATGGTATAAAGTTGT
 
. : . : . : . : . : . :
JMSF040D14+ GTCAAAATTGCACCACTTAACCCTGCAAATCCTTTCAGTATTCCAACTATTGGACCACGG
JMSF039I04+ GTCAAAATTGCACCACTTAACCCTGCAAATCCTTTCAGTATTCCAACTATTGGACCACGG
JMSF025A11+ CAGTATTCCAACTATTGGACCACGG
JMSF044G11+ GTCAAAATTGCACCACTTAACCCTGCAAATCCTTTCAGTATTCCAACTATTGGACCACGG
                      ____________________________________________________________
consensus GTCAAAATTGCACCACTTAACCCTGCAAATCCTTTCAGTATTCCAACTATTGGACCACGG
 
. : . : . : . : . : . :
JMSF040D14+ CTTTTGGGGAAATTTTGAACACTGGAAACTAGAGCCCCAGTATTGAAGTATGTCTCGCCA
JMSF039I04+ CTTTTGGGGAAATTTTGAACACTGGAAACTAGAGCCCCAGTATTGAAGTATGTCTCGCCA
JMFF031C23+ TTGGGGAAATTTTGAACACTGGAAACTAGAGCCCCAGTATTGAAGTATGTCTCGCCA
JMSF025A11+ CTTTTGGGGAAATTTTGAACACTGGAAACTAGAGCCCCAGTATTGAAGTATGTCTCGCCA
JMSF044G11+ CTTTTGGGGAAATTTTGAACACTGGAAACTAGAGCCCCAGTATTGAAGTATGTCTCGCCA
                      ____________________________________________________________
consensus CTTTTGGGGAAATTTTGAACACTGGAAACTAGAGCCCCAGTATTGAAGTATGTCTCGCCA
 
. : . : . : . : . : . :
JMSF040D14+ TTTGTTCCCACAAATATCAAAACGCAAAGCAGCCAAAGAGGGAGCTCAGGAATCTTGTGG
JMSF039I04+ TTTGTTCCCACAAATATCAAAAAGCAAAGCAGCCAAAGAGGGAGCTCAGGAATCTTGTGG
JMFF031C23+ TTTGTTCCCACAAATATCAAAACGCAAAGCAGCCAAAGAGGGAGCTCAGGAATCTTGTGG
JMSF025A11+ TTTGTTCCCACAAATATCAAAACGCAAAGCAGCCAAAGAGGGAGCTCAGGAATCTTGTGG
JMFF027M22+ ACAAATATCAAAACGCAAAGCAGCCAAAGAGGGAGCTCAGGAATCTTGTGG
JMSF044G11+ TTTGTTCCCACAAATATCAAAACGCAAAGCAGCCAAAGAGGGAGCTCAGGAATCTTGTGG
                      ____________________________________________________________
consensus TTTGTTCCCACAAATATCAAAACGCAAAGCAGCCAAAGAGGGAGCTCAGGAATCTTGTGG
 
. : . : . : . : . : . :
JMSF040D14+ GCGACGATAAGCCAGACGAGGCCATAGCCGAAGAAGTTCTGCAAAACGCCAATGAAGAGG
JMSF039I04+ GCGACGATAAGCCAGACGAGGCCATAGCCGAAGAAGTTCTGCAAAACGCCAATGAAGAGG
JMFF031C23+ GCGACGATAAGCCAGACGAGGCCATAGCCGAAGAAGTTCTGCAAAACGCCAATGAAGAGG
JMSF025A11+ GCGACGATAAGCCAGACGAGGCCATAGCCGAAGAAGTTCTGCAAAACGCCAATGAAGAGG
JMFF027M22+ GCGACGATAAGCCAGACGAGGCCATAGCCGAAGAAGTTCTGCAAAACGCCAATGAAGAGG
JMSF044G11+ GCGACGATAAGCCAGACGAGGCCATAGCCGAAGAAGTTCTGCAAAACGCCAATGAAGAGG
                      ____________________________________________________________
consensus GCGACGATAAGCCAGACGAGGCCATAGCCGAAGAAGTTCTGCAAAACGCCAATGAAGAGG
 
. : . : . : . : . : . :
JMSF040D14+ ACGACCCAGATGGGCATAATCTCGCAGAGGACCCCGGGAAGGAAGCCAATAGCATCCCCC
JMSF039I04+ ACGACCCAGATGGGCATAATCTCGCAGAGGACCCCGGGAAGGAAGCCAATAGCATCCCCC
JMFF031C23+ ACGACCCAGATGGGCATAATCTCGCAGAGGACCCCGGGAAGGAAGCCAATAGCATCCCCC
JMSF025A11+ ACGACCCAGATGGGCATAATCTCGCAGAGGACCCCGGGAAGGAAGCCAATAGCATCCCCC
JMFF027M22+ ACGACCCAGATGGGCATAATCTCGCAGAGGACCCCGGGAAGGAAGCCAATAGCATCCCCC
JMSF044G11+ ACGACCCAGATGGGCATAATCTCGCAGAGGACCCCGGGAAGGAAGCCAATAGCATCCCCC
                      ____________________________________________________________
consensus ACGACCCAGATGGGCATAATCTCGCAGAGGACCCCGGGAAGGAAGCCAATAGCATCCCCC
 
. : . : . : . : . : . :
JMSF040D14+ AAGTCCTTAGCGACGCCGAGCATGGCAACCTGCCTCTGATTGTAGCCCATGGCGGTCTTG
JMSF039I04+ AAGTCCTTAGCGACGCCGAGCATGGCAACCTGCCTCTGATTGTAGCCCATGGCGGTCTTG
JMFF031C23+ AAGTCCTTAGCGACGCCGAGCATGGCAACCTGCCTCTGATTGTAGCCCATGGCGGTCTTG
JMSF025A11+ AAGTCCTTAGCGACGCCGAGCATGGCAACCTGCCTCTGATTGTAGCCCATGGCGGTCTTG
JMFF027M22+ AAGTCCTTAGCGACGCCGAGCATGGCAACCTGCNTCTGATTGTAGCCCATGGCGGTCTTG
JMSF044G11+ AAGTCCTTAGCGACGCCGAGCATGGCAACCTGCCTCTGATTGTAGCCCATGGCGGTCTTG
                      ____________________________________________________________
consensus AAGTCCTTAGCGACGCCGAGCATGGCAACCTGCCTCTGATTGTAGCCCATGGCGGTCTTG
 
. : . : . : . : . : . :
JMSF040D14+ ATCACCGGAGAGATGCTGCCGAACAAGTAGCCGATGCCGGAGCAAGACTGTACCCACATT
JMSF039I04+ ATCACCGGAGAGATGCTGCCGAACAAGTAGCCGATGCCGGAGCAAGACTGTACCCACATT
JMFF031C23+ ATCACCGGAGAGATGCTGCCGAACAAGTAGCCGATGCCGGAGCAAGACTGTACCCACATT
JMSF025A11+ ATCACCGGAGAGATGCTGCCGAACAAGTAGCCGATGCCGGAGCAAGACTGTACCCACATT
JMFF027M22+ ATCACCGGAGAGATGCTGCCGAACAAGTAGCCGATGCCGGAGCAAGACTGTACCCACATT
JMSF044G11+ ATCACCGGAGAGATGCTGCCGAACAAGTAGCCGATGCCGGAGCAAGACTGTACCCACATT
                      ____________________________________________________________
consensus ATCACCGGAGAGATGCTGCCGAACAAGTAGCCGATGCCGGAGCAAGACTGTACCCACATT
 
. : . : . : . : . : . :
JMSF040D14+ GAAGCCACGAAAACCAGCCATCTATCATTGAAGAAAGCCTTCACTCTCTCCCCCACCACC
JMSF039I04+ GAAGCCACGAAAACCAGCCATCTATCATTGAAGAAAGCCTTCACTCTCTCCCCCACCACC
JMFF031C23+ GAAGCCACGAAAACCAGCCATCTATCATTGAAGAAAGCCTTCACTCTCTCCCCCACCACC
JMSF025A11+ GAAGCCACGAAAACCAGCCATCTATCATTGAAGAAAGCCTTCACTCTCTCCCCCACCACC
JMFF027M22+ GAAGCCACGAAAACCAGCCATCTATCATTGAAGAAAGCCTTCACTCTCTCCCCCACCACC
JMSF012E19+ CCCACCACC
JMSF044G11+ GAAGCCACGAAAACCAGCCATCTATCATTGAAGAAAGCCTTCACTCTCTCCCCCACCACC
                      ____________________________________________________________
consensus GAAGCCACGAAAACCAGCCATCTATCATTGAAGAAAGCCTTCACTCTCTCCCCCACCACC
 
. : . : . : . : . : . :
JMSF040D14+ ATGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTCTACATACAAATGGAAAGG
JMSF039I04+ ATGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTCTACATACAAATGGAAAGG
JMFF031C23+ ATGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTCTACATACAAATGGAAAGG
JMSF025A11+ ATGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTCTACATACAAATGGAAAGG
JMFF027M22+ ATGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTCTACATACAAATGGAAAGG
JMSF012E19+ ANGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTCTACATACAAATGGAAAGG
JMSF044G11+ ATGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTCTACATACAAATGGAAAGG
                      ____________________________________________________________
consensus ATGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTCTACATACAAATGGAAAGG
 
. : . : . : . : . : . :
JMSF040D14+ AGACAAGTAGGAAGAAGAAC
JMSF039I04+ AGACAAGTAGGAAGAAGAACAGTTGCAGAGAGGATAAGAATCACAATATATAGAAAGAGC
JMFF031C23+ AGACAAGTAGGAAGAAGAACAGTTGCAGAGAGGATAAGAATCACAATATATAGAAAGAGC
JMSF025A11+ AGACAAGTAGGAAGAAGAACAGTTGCAGAGAGGATAAGAATCACAATATATAGAAAGAGC
JMFF027M22+ AGACAAGTAGGAAGAAGAACAGTTGCAGAGAGGATAAGAATCACAATATATAGAAAGAGC
JMSF012E19+ AGACAAGTAGGAAGAAGAACAGTTGCAGAGAGGATAAGAATCACAATATATAGAAAGAGC
JMSF044G11+ AGACAAGTAGGAAGAAGAACAGTTGCAGAGAGGATAAGAATCACAATATATAGAAAGAGC
                      ____________________________________________________________
consensus AGACAAGTAGGAAGAAGAACAGTTGCAGAGAGGATAAGAATCACAATATATAGAAAGAGC
 
. : . : . : . : . : . :
JMSF039I04+ TGAAGAGCTAGAAAGTGGTAGTTGAGAAGGAGGGAGGGAAGGTGTTTGGTGGATGGATAT
JMFF031C23+ TGAAGAGCTAGAAAGTGGTAGTTGAGAAGGAGGGAGGGAAGGTGTTTGGTGGA
JMSF025A11+ TGAAGAGCTAGAAAGTGGTAGTTGAGAAGGAGGGAGGGAAGGTGTTTGGTGGATGGATAT
JMFF027M22+ TGAAGAGCTAGAAAGTGGTAGTTGAGAAGGAGGGAGGGAAGGTGTTTGGTGGA
JMSF012E19+ TGAAGAGCTAGAAAGTGGTAGTTGAGAAGGAGGGAGGGAAGGTGTTTGGTGGATGGATAT
JMSF044G11+ TGAAGAGCTAGAAAGTGGTAGTTGAGAAGGAGGGAGGGAAGGTGTTTGGTGGATGGATAT
                      ____________________________________________________________
consensus TGAAGAGCTAGAAAGTGGTAGTTGAGAAGGAGGGAGGGAAGGTGTTTGGTGGATGGATAT
 
. : . : . : . : . : . :
JMSF039I04+ CC
JMSF025A11+ CCACAGATCAGACGTTTCTCTA
JMSF012E19+ CCACAGATCAGACGTTTCTCTACTCTGAAAATGAATCAAAAA
JMSF044G11+ CCACAGATCAGACGTTTCTCTACTCTGAAAATGAATCAAAAATCGCCACCAACTTCGTTC
                      ____________________________________________________________
consensus CCACAGATCAGACGTTTCTCTACTCTGAAAATGAATCAAAAATCGCCACCAACTTCGTTC