Previous Contig 007601:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030I10Sequence650007601 (2)gb:HTCYP81L_16821642e-58Helianthus tuberosus mRNA for cytochrome P450, CYP81B1l.695013538 (2)gb:HTCYP81L_16821643e-66Helianthus tuberosus mRNA for cytochrome P450, CYP81B1l.
JMSF044E14Sequence666007601 (2)gb:HTCYP81L_16821647e-59Helianthus tuberosus mRNA for cytochrome P450, CYP81B1l.784013538 (2)gb:HTCYP81L_16821642e-80Helianthus tuberosus mRNA for cytochrome P450, CYP81B1l.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030I10+ CAC
                      ____________________________________________________________
consensus CAC
 
. : . : . : . : . : . :
JMSF030I10+ CAAACTGTTCTCCAAGTCCTTGAACACCCCCTTCAACGCCGGCACGAAGTCGCCGACGTT
JMSF044E14+ GACGTT
                      ____________________________________________________________
consensus CAAACTGTTCTCCAAGTCCTTGAACACCCCCTTCAACGCCGGCACGAAGTCGCCGACGTT
 
. : . : . : . : . : . :
JMSF030I10+ GGTTGCCCCGCCGAGGCGGAAAGTGTCCGTTACGATCCCCCTGAACCGCTTTGCCTCCTC
JMSF044E14+ GGTTGCCCCGCCGAGGCGGAAAGTGTCCGTTACGATCCCCCTGAACCGCTTTGCCTCCTC
                      ____________________________________________________________
consensus GGTTGCCCCGCCGAGGCGGAAAGTGTCCGTTACGATCCCCCTGAACCGCTTTGCCTCCTC
 
. : . : . : . : . : . :
JMSF030I10+ GATATCCCCCACATTCTCGCCGTAATACCTTTTCCCGGCGATCATCCTCATCATCACGTT
JMSF044E14+ GATATCCCCCACATTCTCGCCGTAATACCTTTTCCCGGCGATCATCCTCATCATCACGTT
                      ____________________________________________________________
consensus GATATCCCCCACATTCTCGCCGTAATACCTTTTCCCGGCGATCATCCTCATCATCACGTT
 
. : . : . : . : . : . :
JMSF030I10+ CAACGTGAGCTCGAAAAAAAAGCTCTTCATTTCAACGTGCGAATCCGCTTTACTAACCGA
JMSF044E14+ CAACGTGAGCTCGAAAAAAAAGCTCTTCATTTCAACGTGCGAATCCGCTTTACTAACCGA
                      ____________________________________________________________
consensus CAACGTGAGCTCGAAAAAAAAGCTCTTCATTTCAACGTGCGAATCCGCTTTACTAACCGA
 
. : . : . : . : . : . :
JMSF030I10+ GTGCACCTTTCTCACCATGGACTTCACCTCATCCGCGCGGATCCCGTGGAGCATCTGGAG
JMSF044E14+ GTGCACCTTTCTCACCATGGACTTCACCTCATCCGCGCGGATCCCGTGGAGCATCTGGAG
                      ____________________________________________________________
consensus GTGCACCTTTCTCACCATGGACTTCACCTCATCCGCGCGGATCCCGTGGAGCATCTGGAG
 
. : . : . : . : . : . :
JMSF030I10+ GCGATGGG-GGACAGGATTTCGAGGGCGGCGATTTTGCGGAGATTCCGCCAGTGATCGCC
JMSF044E14+ GCGATGGGCGGACAGGATTTCGAGGGCGGCGATTTTGCGGAGATTCCNCCAGTGATCGCC
                      ____________________________________________________________
consensus GCGATGGGCGGACAGGATTTCGAGGGCGGCGATTTTGCGGAGATTCCGCCAGTGATCGCC
 
. : . : . : . : . : . :
JMSF030I10+ GTAGGAGGACCACGCTAGGGAGGTGTAGTTGTAGCCTATGTACTTTCCGGCCATGAGGTG
JMSF044E14+ GTAGGAGGACCACGCTAGGGAGGTGTAGTTGTAGCCTATGTACTTTCCGGCCATGAGGTG
                      ____________________________________________________________
consensus GTAGGAGGACCACGCTAGGGAGGTGTAGTTGTAGCCTATGTACTTTCCGGCCATGAGGTG
 
. : . : . : . : . : . :
JMSF030I10+ CGGCCGGTTCGCGAAAACGATGTCGTTCCTCGACAGACACTCCTCGGCGGCGGAAGGGGT
JMSF044E14+ CGGCCGGTTCGCGAAAACGATGTCGTTCCTCGACAGACACTCCTCGGCGGCGGAAGGGGT
                      ____________________________________________________________
consensus CGGCCGGTTCGCGAAAACGATGTCGTTCCTCGACAGACACTCCTCGGCGGCGGAAGGGGT
 
. : . : . : . : . : . :
JMSF030I10+ GGCGACCAGTAGAACTTTCCTGGACCCGAACTCGAGGAGGAGAACCGGGCCATGGCGGCT
JMSF044E14+ GGCGACCAGTAGAACTTTCCTGGACCCGAACTCGAGGAGGAGAACCGGGCCATGGCGGCT
                      ____________________________________________________________
consensus GGCGACCAGTAGAACTTTCCTGGACCCGAACTCGAGGAGGAGAACCGGGCCATGGCGGCT
 
. : . : . : . : . : . :
JMSF030I10+ GGAGATTTTGTCCAAGGCGCGGTGGAGAGGTTTCTTAAAGAGGTATAGATGGCCGAGGAG
JMSF044E14+ GGAGATTTTGTCCAAGGCGCGGTGGAGAGGTTTCTTAAAGAGGTATAGATGGCCGAGGAG
                      ____________________________________________________________
consensus GGAGATTTTGTCCAAGGCGCGGTGGAGAGGTTTCTTAAAGAGGTATAGATGGCCGAGGAG
 
. : . : . : . : . : . :
JMSF030I10+ GGGGAGAGTGAGGAACGGCGCCGGTGGATGGTTCTTGAATTTCCGGT
JMSF044E14+ GGGGAGAGTGAGGAACGGCGCCGGTGGATGGTTCTTGAATTTCCGGTGAAACGTGTTTGG
                      ____________________________________________________________
consensus GGGGAGAGTGAGGAACGGCGCCGGTGGATGGTTCTTGAATTTCCGGTGAAACGTGTTTGG
 
. : . : . : . : . : . :
JMSF044E14+ AGATTAAGTACAAGGGAAAGAGGATGGCAAGGTACAAGAATGGGTTGATGAGGTAACCCC
                      ____________________________________________________________
consensus AGATTAAGTACAAGGGAAAGAGGATGGCAAGGTACAAGAATGGGTTGATGAGGTAACCCC